Aethes williana

(Brahm, 1791) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records241

Data sources7

Biological traits2

DNA specimens19

eDNA detections0

Sources7 archives

Databases and archives Aethes williana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility241 records↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF241 records

DNA & barcodingBOLD19 specimens

01Narrative

Aethes williana, the silver carrot conch, is a species of moth of the family Tortricidae. It was described by Nikolaus Joseph Brahm in 1791. It is found in most of Europe, Trans-Caspia, Asia Minor, Mongolia, north-western Africa and Iran., 2009: Synopsis of the Cochylini (Tortricidae: Tortricinae: Cochylini) of Iran, with the description of a new species. Zootaxa 2245: 1-31. It is found in dry, sandy and chalky habitats. The wingspan is 13 –.Microlepidoptera.nl Adults are on wing from May to early August. The larvae feed on Daucus carota, Helichrysum arenarium, Helichrysum stoechas, Eryngium campestre, Eryngium maritimum, Gnaphalium species and Ferula communis. They bore into the lower part of the stem and the roots of their host plant, feeding from within. Larvae can be found in May and June.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes williana has left across the world's sequence archives.

At a glance

DNA specimens19

BINs3

Marker genes1

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

91Amostly conserved

92Cmostly conserved

100Amostly conserved

142Cmostly conserved

205Cmostly conserved

259Tmostly conserved

280Cmostly conserved

283Amostly conserved

382Tmostly conserved

412Avariable

475Tvariable

520Tmostly conserved

562Tmostly conserved

578Cmostly conserved

628Avariable

646Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes7

BINs3

Most divergent pair3.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethes margarotanasame genus2.6%Aethes capnospilasame genus4.4%Aethes francillanasame genus7.0%Gynnidomorpha minimanasame family8.1%Gynnidomorpha luridanasame family8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type241 records

Wild obs. + sensor197

Museum / vouchered32

Other12

Range

Area of Occupancy AOO660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 56≤1 km 25≤10 km 62>10 km 4

147 georeferenced · 50 without coordinates

Open the mapobservation + sensor197

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 1≤1 km 7≤10 km 1

9 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	10
ZAF-UMUlocation not on record	5
Provincia di Livornolocation not on record	4
European Distributed Institute of Taxonomy (EDIT)location not on record	1
University of Kaiserslauternlocation not on record	1

5 institutions · 21 of 32 vouchered records shown · 11 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)