Aethes seriatana

(Zeller, 1875) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records587

Data sources8

Biological traits0

DNA specimens20

eDNA detections12

Sources8 archives

Databases and archives Aethes seriatana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility587 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF587 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD20 specimens

01Narrative

Aethes seriatana, the seriated aethes moth, is a species of moth of the family Tortricidae. It was described by Zeller in 1875. It is found in North America, where it has been recorded in the south-eastern United States from Texas to Florida, and north to Maryland.Aethes at funetBug Guide It is also found on Cuba and Bermuda. The wingspan is 11 –. Adults have been recorded on wing all months of the year, but flight times depend on the location.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes seriatana has left across the world's sequence archives.

At a glance

DNA specimens20

BINs3

Marker genes1

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

85Cmostly conserved

197Cmostly conserved

247Cmostly conserved

349Gmostly conserved

469Gmostly conserved

547Cmostly conserved

646Tmostly conserved

652Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACATCTTTAAGTTTATTAATTCGAGCCGAATTAGGTAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.94%

Haplotypes5

BINs3

Most divergent pair7.6%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethes razowskiisame genus7.3%Aethes patriciasame genus7.3%Aethes baloghisame genus7.3%Aethes promptanasame genus7.7%Aethes angustanasame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type587 records

Wild obs. + sensor501

Museum / vouchered86

Range

Area of Occupancy AOO1 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 269≤1 km 77≤10 km 16>10 km 64

426 georeferenced · 75 without coordinates

Open the mapobservation + sensor501

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤1 km 1≤10 km 13>10 km 7

21 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence86

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	64
Cornell University Insect Collectionlocation not on record	10
New Haven, US	6
Champaign, US	4
Cambridge, US	1

5 institutions · 85 of 86 vouchered records shown · 1 without an institution code

09Environmental DNA12 detections

Where the DNA of Aethes seriatana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

Mixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 17.4–27.4

Seasonal swing summer↔winter26.0 °C

Max temp (day)25.6 °C 21.7–33.0

Min temp (night)18.4 °C 14.0–23.1

Precipitation88.8 mm/mo 79.6–140

Air humidity57.5 % 54.6–59.7

Moisture balance-78.7 mm/mo -116–-23.6

Vapour deficit1,027 Pa 838–1,665

Wind speed4.40 m/s 3.00–5.50

Cloud cover38.6 % 27.2–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)