Aethes sanguinana

(Treitschke, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records24

Data sources7

Biological traits0

DNA specimens3

eDNA detections0

Sources7 archives

Databases and archives Aethes sanguinana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility24 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF24 records

DNA & barcodingBOLD3 specimens

01Narrative

Aethes sanguinana is a species of moth of the family Tortricidae. It was described by Treitschke in 1830. It is found in most of southern and central Europe, Morocco, Algeria and Asia Minor.Aethes at funet The wingspan is 13 –. Adults are on wing from May to July. The larvae feed on Eryngium campestre. Larvae have been recorded from January to March, in July and from September to December.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes sanguinana has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 530 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

219Avariable

333Avariable

486Cvariable

515Avariable

708Tvariable

834Gvariable

1002Cvariable

1098Tvariable

1269Tvariable

1320Tvariable

1493Cvariable

CGAAAATGACTTTTTTCTACAAATCATAAAGATATTGGAACATTATATTTTATTTTTGGTATCTGAGCAGGTATAGTAGGAACTTCTTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes3

BIN1

Most divergent pair0.72%

EuropeAfrica

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type24 records

Wild obs. + sensor11

Museum / vouchered12

Other1

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 3≤10 km 6

10 georeferenced · 1 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	8

1 institutions · 8 of 12 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)