Aethes atomosana

(Busck, 1907) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records232

Data sources8

Biological traits0

DNA specimens9

eDNA detections7

Sources8 archives

Databases and archives Aethes atomosana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility232 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF232 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD9 specimens

01Narrative

Aethes atomosana, the two-spotted aethes, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Nova Scotia, Ontario, Illinois, Indiana, Maryland, Michigan, Pennsylvania, Vermont and Wisconsin.Aethes at funet The length of the forewings is 6.6–9.8 mm. The forewings are light ochreous, suffused with darker ochreous scales. The hindwings are light ochreous fuscous.Busck, A., 1907. A review of the tortricid subfamily Phaloniinae with descriptions of new American species. Journal of The New York Entomological Society, 15(1): 22 Adults are on wing from June to September,Bug Guide probably in one generation per year.Revised identities and new species of Aethes from midwestern North America (Tortricidae)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes atomosana has left across the world's sequence archives.

At a glance

DNA specimens9

BINs3

Marker genes1

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 61 variable positions, in barcode order

28Gmostly conserved

38Gvariable

40Tmostly conserved

43Tmostly conserved

76Gvariable

79Tmostly conserved

82Cmostly conserved

88Gmostly conserved

91Amostly conserved

100Gmostly conserved

118Tmostly conserved

127Cmostly conserved

133Cmostly conserved

139Tmostly conserved

166Gmostly conserved

172Cmostly conserved

187Tmostly conserved

199Gmostly conserved

200Gmostly conserved

217Amostly conserved

220Tmostly conserved

223Tmostly conserved

250Tmostly conserved

263Tmostly conserved

266Cmostly conserved

271Tvariable

287Cmostly conserved

307Amostly conserved

316Gvariable

319Amostly conserved

328Amostly conserved

337Amostly conserved

346Amostly conserved

349Tmostly conserved

364Cmostly conserved

373Gvariable

376Amostly conserved

382Cmostly conserved

400Tmostly conserved

439Amostly conserved

469Cvariable

472Tmostly conserved

506Gmostly conserved

508Tmostly conserved

511Amostly conserved

533Cmostly conserved

536Cmostly conserved

550Cmostly conserved

565Amostly conserved

568Tmostly conserved

571Tmostly conserved

574Amostly conserved

598Amostly conserved

601Cmostly conserved

604Cmostly conserved

616Cmostly conserved

622Gmostly conserved

625Tmostly conserved

628Amostly conserved

631Tmostly conserved

634Cmostly conserved

AACACTATATTTTATTTTTGGTATTTGGGCAGGAATAGTTGGTACATCTTTAAGTTTACTAATTCGAGCAGAATTGGGTAACCCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes5

BINs3

Most divergent pair6.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethes angustanasame genus5.8%Aethes floccosanasame genus6.7%Aethes helenianasame genus7.1%Aethes baloghisame genus7.1%Aethes interruptofasciatasame genus7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type232 records

Wild obs. + sensor217

Museum / vouchered15

Range

Area of Occupancy AOO568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 142≤1 km 22≤10 km 3>10 km 19

186 georeferenced · 31 without coordinates

Open the mapobservation + sensor217

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 1≤10 km 3>10 km 4

8 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	6
East Lansing, US	4
St. Paul, US	3
New Haven, US	2

4 institutions · 15 of 15 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Aethes atomosana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 14.7–19.9

Seasonal swing summer↔winter30.8 °C

Max temp (day)20.1 °C 19.6–24.1

Min temp (night)11.8 °C 11.3–16.6

Precipitation87.7 mm/mo 80.7–110

Air humidity60.6 % 59.5–61.1

Moisture balance1.80 mm/mo -31.8–18.2

Vapour deficit658 Pa 655–933

Wind speed3.00 m/s 2.70–3.10

Cloud cover53.0 % 43.6–53.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)