Aethes angulatana

(Robinson, 1869) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records88

Data sources8

Biological traits0

DNA specimens28

eDNA detections19

Sources8 archives

Databases and archives Aethes angulatana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility88 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF88 records

Environmental DNA1 datasets · 2 countries19 detections

DNA & barcodingBOLD28 specimens

01Narrative

Aethes angulatana, the angular aethes, is a species of moth of the family Tortricidae. It is found from Quebec and Maine to Florida, west to Texas and north to Minnesota. The wingspan is 10–16 mm. The forewings are pale yellowish or cream with dark brownish-grey markings. The hindwings are drab grey with a paler fringe. Adults are on wing from June to September in the northern part of the range but earlier in the south.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes angulatana has left across the world's sequence archives.

At a glance

DNA specimens28

BINs6

Marker genes1

eDNA detections19

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 55 variable positions, in barcode order

4Avariable

22Tmostly conserved

38Amostly conserved

43Tvariable

59Tmostly conserved

73Amostly conserved

88Amostly conserved

100Tvariable

118Cmostly conserved

133Avariable

139Tvariable

154Cmostly conserved

166Amostly conserved

178Tvariable

181Amostly conserved

202Tmostly conserved

208Amostly conserved

217Amostly conserved

220Cvariable

235Cmostly conserved

238Tvariable

265Amostly conserved

268Cmostly conserved

271Cmostly conserved

325Amostly conserved

337Gmostly conserved

364Tvariable

367Tmostly conserved

409Amostly conserved

433Amostly conserved

445Tvariable

451Cvariable

463Tmostly conserved

469Tmostly conserved

506Gmostly conserved

512Tmostly conserved

514Tmostly conserved

520Amostly conserved

530Tvariable

547Cvariable

550Cmostly conserved

556Tmostly conserved

565Amostly conserved

574Tvariable

581Tmostly conserved

589Tmostly conserved

596Cmostly conserved

598Tmostly conserved

601Tmostly conserved

616Cmostly conserved

622Tmostly conserved

628Tmostly conserved

646Cmostly conserved

653Tmostly conserved

658Tvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGTACATCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes17

BINs6

Most divergent pair6.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethes matherisame genus1.8%Aethes mymarasame genus3.2%Aethes biscanasame genus3.6%Aethes sexdentatasame genus3.6%Aethes terriaesame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type88 records

Wild obs. + sensor56

Museum / vouchered32

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 28≤1 km 6≤10 km 4>10 km 6

44 georeferenced · 12 without coordinates

Open the mapobservation + sensor56

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 2≤1 km 3≤10 km 6

11 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	10
New Haven, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Mississippi State, US	2
East Lansing, US	2
Cornell University Insect Collectionlocation not on record	2
San Francisco, US	1
Champaign, US	1

8 institutions · 27 of 32 vouchered records shown · 5 without an institution code

09Environmental DNA19 detections

Where the DNA of Aethes angulatana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland|1.1. Boreal Forest1. Forest & WoodlandTexas Hill CountryPin Rigide - Mixte

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 13.8–22.8

Seasonal swing summer↔winter28.6 °C

Max temp (day)22.5 °C 18.4–28.4

Min temp (night)14.0 °C 10.5–18.6

Precipitation93.1 mm/mo 77.3–116

Air humidity60.0 % 56.0–61.2

Moisture balance-30.9 mm/mo -56.2–25.5

Vapour deficit794 Pa 612–1,241

Wind speed2.90 m/s 2.30–3.90

Cloud cover43.5 % 27.2–53.1

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)