Aethaloida packardaria

(Hulst, 1888) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Aethaloida

At a glance

Occurrence records512

Data sources8

Biological traits0

DNA specimens83

eDNA detections79

Sources8 archives

Databases and archives Aethaloida packardaria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility512 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI79 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics83 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF512 records

Environmental DNA1 datasets · 2 countries79 detections

DNA & barcodingBOLD83 specimens

01Narrative

Aethaloida is a monotypic moth genus in the family Geometridae erected by James Halliday McDunnough in 1920. Its only species, Aethaloida packardaria, was first described by George Duryea Hulst in 1888. It is found in the US state of California.Note: This source appears to misspell the specific name.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding83 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethaloida packardaria has left across the world's sequence archives.

At a glance

DNA specimens83

BINs2

Marker genes5

eDNA detections79

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus70 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

31Gmostly conserved

37Amostly conserved

70Amostly conserved

76Amostly conserved

79Cmostly conserved

112Cmostly conserved

160Avariable

202Tmostly conserved

214Tmostly conserved

265Gmostly conserved

301Tmostly conserved

325Tmostly conserved

334Amostly conserved

349Gmostly conserved

361Tmostly conserved

367Gmostly conserved

370Gvariable

418Cmostly conserved

430Gvariable

463Avariable

497Cmostly conserved

502Tmostly conserved

511Amostly conserved

536Cmostly conserved

547Avariable

553Amostly conserved

583Amostly conserved

616Tmostly conserved

622Tmostly conserved

625Amostly conserved

631Cmostly conserved

637Tmostly conserved

643Cmostly conserved

646Amostly conserved

ATTATATTTTATTTTTGGTATTTGAGCAGGGATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAACCCAGGATCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes30

BINs2

Most divergent pair4.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eucaterva variariasame family8.9%Meris alticolasame family9.0%Epigynopteryx stictigrammasame family9.0%Parilexia cermalasame family9.2%Eumera reginasame family9.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P16S28SEF1-alpha

animal barcoderibosomalmarker

08Occurrence & distribution

Record type512 records

Wild obs. + sensor196

Museum / vouchered316

Origin

Native3

Range

Area of Occupancy AOO612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 77≤1 km 30≤10 km 29>10 km 11

147 georeferenced · 49 without coordinates

Open the mapobservation + sensor196

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 56≤1 km 111≤10 km 117>10 km 27

311 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence316

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	202
New Haven, US	61
Santa Cruz, US	24
Colorado State Universitylocation not on record	16
ASUlocation not on record	4
Los Angeles, US	3
San Francisco, US	2
Denver, US	1
US	1
University of Marylandlocation not on record	1
East Lansing, US	1

11 institutions · 316 of 316 vouchered records shown

09Environmental DNA79 detections

Where the DNA of Aethaloida packardaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found79

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 79 detections have coordinates

Open the map2 countries0

Marsh14. Artificial - Terrestrial|14.5 Urban AreasUrbanPines

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 13.4–23.7

Seasonal swing summer↔winter9.50 °C

Max temp (day)24.0 °C 18.3–33.1

Min temp (night)14.7 °C 9.70–18.2

Precipitation2.70 mm/mo 1.50–32.3

Air humidity60.0 % 43.0–67.2

Moisture balance-150 mm/mo -188–-69.2

Vapour deficit901 Pa 635–1,558

Wind speed2.10 m/s 1.50–3.60

Cloud cover15.6 % 12.2–28.9

CHELSA 1981–2010, ~9 km grid, at location & month of 67 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)