Aethaloessa calidalis

(Guenée, 1854) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Aethaloessa

At a glance

Occurrence records618

Data sources7

Biological traits0

DNA specimens16

eDNA detections17

Sources7 archives

Databases and archives Aethaloessa calidalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility618 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF618 records

Environmental DNA1 datasets · 8 countries17 detections

DNA & barcodingBOLD16 specimens

01Narrative

Aethaloessa calidalis is a moth of the family Crambidae described by Achille Guenée in 1854. It is found throughout the Seychelles, South and South-East Asia, Australia and on many Pacific islands. This moth figured on an 8-cent stamp of Tuvalu in 1980."Aethaloessa calidalis (Guenée, 1854)". Australian Caterpillars and their Butterflies and Moths. Retrieved March 8, 2018. (Includes the Tuvalu stamp.)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethaloessa calidalis has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections17

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.03%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

646Cmostly conserved

TACTTTATACTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Patania deficienssame family5.6%Cnaphalocrocis poeyalissame family5.6%Phostria lanialissame family5.8%Glyphodes onychinalissame family5.8%Cnaphalocrocis patnalissame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type618 records

Wild obs. + sensor608

Museum / vouchered10

Range

Area of Occupancy AOO1 532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 266≤1 km 118≤10 km 57>10 km 53

494 georeferenced · 114 without coordinates

Open the mapobservation + sensor608

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 1

4 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Essig Museum of Entomologylocation not on record	3
Australian National Insect Collectionlocation not on record	3
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

3 institutions · 7 of 10 vouchered records shown · 3 without an institution code

09Environmental DNA17 detections

Where the DNA of Aethaloessa calidalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map8 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 23.8–28.0

Seasonal swing summer↔winter5.70 °C

Max temp (day)27.2 °C 25.8–28.7

Min temp (night)24.6 °C 19.4–27.2

Precipitation238 mm/mo 139–359

Air humidity65.4 % 62.3–67.1

Moisture balance109 mm/mo

Vapour deficit1,215 Pa 983–1,298

Wind speed3.10 m/s

Cloud cover48.4 % 17.1–73.6

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)