Aetea truncata

(Landsborough, 1852) · species

image placeholder — illustration coming later

Animalia/Bryozoa/Gymnolaemata/Cheilostomatida/Aeteidae/Aetea

At a glance

Occurrence records537

Data sources7

Biological traits4

DNA specimens6

eDNA detections0

Sources7 archives

Databases and archives Aetea truncata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility367 records↗

OBISOcean Biodiversity Information System170 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS537 records

DNA & barcodingBOLD6 specimens

01Narrative

Aetea truncata est une espèce de bryozoaire de la famille des Aeteidae. Cet ectoprocte est présent dans plusieurs océans : notamment en mer du Nord et dans les eaux néo-zélandaises. L'holotype a été récolté dans les eaux britanniques avec pour nom scientifique original Anguinaria truncata. L'espèce est une proie du nudibranche Limacia clavigera. Organisme épibionte, l'espèce s'observe parfois sur les colonies de Chartella tenella.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits2

Depth max55 m

Depth min0 m

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aetea truncata has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P632 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.19%

Haplotypes2

BIN1

Most divergent pair0.32%

Where individuals differ — all 3 variable positions, in barcode order

34Tmostly conserved

220Tmostly conserved

403Amostly conserved

TACTTTATATTTTCTTTTTGGTCTGTGAGCTGGTATAGTAGGAAGGGGCCTTAGTGGTCTCATTCGAGCCGAGTTGAGACAGCCTGGTAG …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type537 records

Wild obs. + sensor109

Museum / vouchered401

Other27

Origin

Native8

Range

Area of Occupancy AOO996 km²

Depth

0–200 m sunlit94

200–1000 m twilight3

1–4 km midnight0

>4 km abyssal0

median 36.8 m · max 493 m · 97 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 42≤1 km 16≤10 km 11

69 georeferenced · 40 without coordinates

Open the mapobservation + sensor109

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 70≤1 km 21≤10 km 3>10 km 2

96 georeferenced · 305 without coordinates

Open the institutions mapphysical evidence401

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	40
Bergen, NO	28
Museo Nacional de Ciencias Naturales (CSIC)location not on record	27
Honolulu, US	26
NHMOlocation not on record	21
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	20
Earth Sciences New Zealandlocation not on record	17
Frankfurt am Main	16
CEFASlocation not on record	14
Santa Barbara Museum of Natural Historylocation not on record	13
Gothenburg, SE	8
Texas Cooperative Wildlife Collectionlocation not on record	7
	7
Universiteit van Amsterdam, Zoologisch Museumlocation not on record	5
Washington, US	3
South Kensington, GB	3
National Marine Biodiversity Institute of Korealocation not on record	2
INSTMlocation not on record	2
Barcelona, ES	2
CASlocation not on record	1
Citadel Hill, GB	1
Helsinki, FI	1
Natural History Museum Rotterdamlocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
SLU Artdatabankenlocation not on record	1
Sydney, AU	1
Hellenic Centre of Marine Research; Institute for Oceanographylocation not on record	1
DASSHlocation not on record	1
Institut Francais pour l'Etude de la Merlocation not on record	1

29 institutions · 271 of 401 vouchered records shown · 15 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)