Aesculus carnea

Hayne · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Sapindaceae/Aesculus

At a glance

Occurrence records11 792

Data sources6

Biological traits1

DNA specimens0

eDNA detections6

Sources6 archives

Databases and archives Aesculus carnea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 792 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Chemical compositionNPASS13 compounds

Occurrence & distributionGBIF11 792 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingNCBIsequences

Genome at a glanceGoaTgenome

01Narrative

Le marronnier à fleurs rouge ou marronnier rose est une espèce d’arbres décoratifs de la famille des Hippocastanacées. C'est un hybride entre Aesculus hippocastanum et Aesculus pavia. C'est un hybride fertile qui produit des graines viables. Il est souvent planté dans les villes. Le premier exemplaire connu en Europe a fleuri en 1815 au Jardin des Plantes à Paris ; il était né de graines semées par Ferdinand Noël, qui les avait reçues de François André Michaux, en 1812. Son feuillage est plus sombre, un peu lustré et comme gaufré, plus petit, plus ferme que celui de l'hippocastanum, il résiste mieux à la sécheresse ; ses fleurs, plus tardives (mi-juin), sont d'un rose plus ou moins carminé ; ses fruits vert-bronze sont dépourvus d'épines ; ses bourgeons ne sont pas poisseux. De taille plus petite et de croissance plus lente, celui ci a une cime plus compacte et plus arrondie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesLEDA

Habitat & environment1

Woodinesswoody

03Chemical composition13 compounds

Compounds documented for Aesculus carnea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Stigmastane steroids5

Cholestane steroids4

Flavan-3-ols1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,4S,5'S,6S,7S,10S,12S)-5',12,17-trihydroxy-6-methylspiro[3,8-dioxahexacyclo[11.8.0.02,4.02,10.06,10.014,19]henicosa-1(13),14(19),15,17-tetraene-7,4'-oxolane]-2',20-dione	present	NPASS
(3S,8S,9S,10R,13R,14S,17R)-17-[(2R,5S)-5-hydroperoxy-5-propan-2-ylhept-6-en-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(3S,8S,9S,10R,13R,14S,17R)-17-[(E,2R)-7-hydroperoxy-5-propan-2-ylhept-5-en-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(6R,8S,9S,10R,13R,14S,17R)-17-[(2R,5S)-5-hydroperoxy-5-propan-2-ylhept-6-en-2-yl]-6-hydroxy-10,13-dimethyl-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one	present	NPASS
(6R,8S,9S,10R,13R,14S,17R)-6-hydroxy-10,13-dimethyl-17-[(E,2R)-5-propan-2-ylhept-5-en-2-yl]-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one	present	NPASS
(8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-[(E,2R)-5-propan-2-ylhept-5-en-2-yl]-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one	present	NPASS
(8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-[(E,2R)-5-propan-2-ylhept-5-en-2-yl]-2,7,8,9,11,12,14,15,16,17-decahydro-1H-cyclopenta[a]phenanthrene-3,6-dione	present	NPASS
(8S,9S,10R,13R,14S,17R)-17-[(2R,5S)-5-hydroperoxy-5-propan-2-ylhept-6-en-2-yl]-10,13-dimethyl-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one	present	NPASS
(8S,9S,10R,13R,14S,17R)-17-[(2R,5S)-5-hydroperoxy-5-propan-2-ylhept-6-en-2-yl]-10,13-dimethyl-2,7,8,9,11,12,14,15,16,17-decahydro-1H-cyclopenta[a]phenanthrene-3,6-dione	present	NPASS
Fucosterol	present	NPASS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aesculus carnea has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections6

The DNA barcodea real sequence read deposited for this species

ITSOR234930.1 ↗393 bp

ACGT

ATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCATTCGGCCGAGGGCACGT …

Aesculus x carnea isolate A76 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Aesculus carnea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidypolyploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type11 792 records

Wild obs. + sensor751

Museum / vouchered217

Cultivated / captive10 821

Other3

Origin

Introduced7

Range

Area of Occupancy AOO2 440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 105≤1 km 380≤10 km 109

594 georeferenced · 157 without coordinates

Open the mapobservation + sensor751

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 7≤1 km 33≤10 km 13>10 km 5

58 georeferenced · 159 without coordinates

Open the institutions mapphysical evidence217

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 30

30 georeferenced · 10 791 without coordinates

Open the mapnot free-living10 821

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 50 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Görlitz, DE	25
Karlsruhe, DE	16
Mlocation not on record	9
Bangkok, TH	8
Oskarshamn, SE	8
CICYTEXlocation not on record	6
FFPRIlocation not on record	6
Santa Barbara, US	5
Auckland, NZ	5
Adam Mickiewicz University in Poznańlocation not on record	5
Uniwersytet Warszawskilocation not on record	5
MAlocation not on record	4
Vitoria, ES	4
Kingston, US	3
inatura Erlebnis Naturschau GmbHlocation not on record	3
Toronto, CA	3
Bloomington, US	3
LDlocation not on record	3
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	3
Canadian Department of Agriculturelocation not on record	3
Provincia di Livornolocation not on record	2
College Park, US	2
Uniwersytet w Białymstokulocation not on record	2
BFLlocation not on record	2
Turlock, US	2
Santa Cruz, US	2
Dekalb, US	2
Bronx, US	2
Clemson, US	2
Natural History Museum Rotterdamlocation not on record	2
Logan, US	1
BClocation not on record	1
Moscow, US	1
Salamanca, ES	1
Uniwersytet Wrocławskilocation not on record	1
Long Beach, US	1
San Jose, US	1
Pocatello, US	1
Pamplona, ES	1
College of the Atlantic, Museumlocation not on record	1
SLU Artdatabankenlocation not on record	1
Denver, US	1
Ann Arbor, US	1
Wuzhou, CN	1
Northridge, US	1
San Sebastián, ES	1
Nagano City, JP	1
WTUlocation not on record	1
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record	1
Saint Louis, US	1

50 institutions · 167 of 217 vouchered records shown · 24 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Aesculus carnea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aesculus carnea

At a glance

Sources6 archives

Habitat & environment1

Compound class profile3 classes

Documented compounds13 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type11 792 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions30 of 50 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type11 792 records