Aeschynomene indica
speciesAt a glance
Occurrence records6 805
Data sources13
Biological traits46
DNA specimens21
eDNA detections19
Sources13 archives
Databases and archives Aeschynomene indica's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility6 805 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics21 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources46 traits
Chemical compositionNPASS11 compounds
Occurrence & distributionGBIF6 805 records
Environmental DNA1 datasets · 2 countries19 detections
DNA & barcodingBOLD · NCBI21 specimens
Genome at a glanceCCDB2n = 40
01Narrative
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology20
Fruit length3.5 mm
Fruit width4.5 mm
Leaf length9.5 mm
Leaf length max10 mm
Leaf length min5 mm
Leaf width1.8 mm
Leaf width max3 mm
Leaf width min1 mm
Petiole length0.75 cm
Plant height2 m
⚠ sources differ — GIFT: 2 m · AusTraits: 1 m · TRY: 1.4 m
Plant height max5 m
Plant height min0.2 m
Seed length4 mm
Seed mass7.56 mg
Seed mass max10 mg
Seed mass min0.9 mg
Seed volume7.1 mm³
Seed volume max7.1 mm³
Seed volume min7.1 mm³
Seed width3 mm
Life cycle & reproduction9
Dispersal typewater
Flowering timeyyyyynnnnnny
Life formannual, perennial or subshrub
Life spanannual/perennial
⚠ sources differ — TRY: annual/perennial · AusTraits: annual · GIFT: annual
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproductive maturity1 years
Resprouting capacityfire_killed
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typelegume
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb shrub · TRY: Herb
Habitat GIFTroadsides, open, riparian
Leaf compoundnesscompound
Leaf shapeoblong
Mycorrhiza type5.87E-14
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
03Chemical composition11 compounds
Compounds documented for Aeschynomene indica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Isoquinoline alkaloids $ Protoberberine alkaloids4
Aporphine alkaloids $ Isoquinoline alkaloids3
Aporphine alkaloids1
Documented compounds11 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Corydalmine | present | NPASS | |
| (-)-Phanostenine | present | NPASS | |
| (6aR)-2-hydroxy-1-methoxy-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinoline-6-carbaldehyde | present | NPASS | |
| 14,15-Dimethoxy-3,5-dioxa-10-azapentacyclo[9.7.1.02,6.08,19.013,18]nonadeca-1(18),2(6),7,11(19),12,14,16-heptaen-9-one | present | NPASS | |
| 7H-Benzo(g)-1,3-benzodioxolo(6,5,4-de)quinoline-7-carboxaldehyde,5,6,7a,8-tetrahydro-, (7aR)- | present | NPASS | |
| Dehydrocorydalmine | present | NPASS | |
| Epicorynoxidine | present | NPASS | |
| FCZORVXRVVKVLF-SZNDQCEHSA-N | present | NPASS | |
| NKRHOILNOKGLBP-UEXGIBASSA-N | present | NPASS | |
| Palmatine | present | NPASS |
05DNA & barcoding21 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeschynomene indica has left across the world's sequence archives.
At a glance
DNA specimens21
Marker genes6
GenBank sequences10
eDNA detections19
Countries5
The DNA barcodea real sequence read deposited for this species
GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGATGCCTCGACCCAGCTAGACCCGCGAATGTGTTTTACAACTCGGGG …
Aeschynomene indica voucher Aindica4x_JFA106 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK4★rbcL3★trnL★ITS3★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Aeschynomene indica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidypolyploid inferred
Chromosome records40–402n range40median40mode12records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4012×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-indian_vol1 +2
CCDB · ipcn-api-dl — Sidhu, M. & S. S. Bir. 1983. Karyological studies on weeds on cultivable lands in Punjab, India. Trop. Plant Sci. Res. 1: 1–13.
CCDB · ipcn-api-dl — Bairiganjan, G. C. & S. N. Patnaik. 1989. Chromosomal evolution in Fabaceae. Cytologia 54: 51–64.
CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1990. Karyomorphological evolution in Papilionaceae. J. Cytol. Genet. 25: 173–219.
CCDB · ipcn-api-dl — Kumar, M. G. V. & P. I. Kuriachan. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 145–147.
CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.
CCDB · book-ipcn75-78 — Bir & Kumari 1977
CCDB · book-indian_vol1 — Kawakami, I. 1930; Berger, C.A. et at. 1958 ; Srivastava, M.G. 1959 ; Bir, S.S. & Sidhu, S. 1966, 1967
CCDB · book-fedorov — Kawakami 1930
CCDB · book-fedorov — Berger C. A. et &1. 1958
CCDB · book-fedorov — Bir, Sidhu (C. n. VI. 1966) c
CCDB · book-fedorov — Berger C. A. eta!. 1958
CCDB · Cave1958 — Berger et al. 1958
n 207×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +1
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.
CCDB · ipcn-api-dl — Bairiganjan, G. C. & S. N. Patnaik. 1989. Chromosomal evolution in Fabaceae. Cytologia 54: 51–64.
CCDB · ipcn-api-dl — Kumar, M. G. V. & P. I. Kuriachan. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 145–147.
CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.
CCDB · book-ipcn66 — Bir & Sidhu 1966
CCDB · book-ipcn67-71 — BIR, S.S. & S. SIDHU. 1967. Cytological observations on the North Indian members of family Leguminosae. Nucleus 10: 47-63.
CCDB · book-ipcn75-78 — Bir & Kumari 1977
n 192×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn75-78 — Sharma 1970
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type6 805 records
Wild obs. + sensor3 057
Museum / vouchered3 276
Cultivated / captive29
Other443
Origin
Native129
Introduced8
Range
Area of Occupancy AOO16 096 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy85% within 1 km
≤100 m 1 077≤1 km 57≤10 km 179>10 km 29
1 342 georeferenced · 1 715 without coordinates
Open the mapobservation + sensor3 057
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy50% within 1 km
≤100 m 323≤1 km 175≤10 km 415>10 km 88
1 001 georeferenced · 2 275 without coordinates
Open the institutions mapphysical evidence3 276
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 3
4 georeferenced · 25 without coordinates
Open the mapnot free-living29
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions113 of 216 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Brisbane, AU | 295 |
| Palmerston, AU | 171 |
| Beijing, CN | 124 |
| Guangzhou, CN | 109 |
| Canberra, AU | 108 |
| Nanjing, CN | 90 |
| Museo Entomologico de Leonlocation not on record | 88 |
| Taipei, TW | 67 |
| Adelaide, AU | 65 |
| Kensington, AU | 64 |
| Saint Louis, US | 63 |
| Mount Annan, AU | 56 |
| Chiba, JP | 54 |
| Odawara, JP | 52 |
| Bronx, US | 52 |
| Nagano City, JP | 50 |
| Pretoria, ZA | 49 |
| Toyama, JP | 48 |
| Kochi, JP | 45 |
| Kew, GB | 44 |
| Jena Microbial Resource Collectionlocation not on record | 43 |
| Kunming, CN | 43 |
| Xiamen, CN | 43 |
| Yangling, CN | 38 |
| Paris, FR | 34 |
| Chengdu, CN | 34 |
| National Institute of Biological Resourceslocation not on record | 33 |
| Sanda, JP | 29 |
| HNBlocation not on record | 28 |
| Guilin, CN | 28 |
| Austin, US | 28 |
| Smithfield, AU | 27 |
| Shanghai, CN | 27 |
| Guangzhou, CN | 25 |
| Wuhan, CN | 24 |
| Frankfurt am Main | 22 |
| Bando, JP | 21 |
| Tsukuba, JP | 21 |
| Fukushima Universitylocation not on record | 20 |
| JP | 20 |
| Chapel Hill, US | 18 |
| Taipei, TW | 18 |
| MeiseBGlocation not on record | 18 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 18 |
| Tokushima, JP | 17 |
| Shinshu Universitylocation not on record | 17 |
| Tampa, US | 17 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 17 |
| Sendai, JP | 14 |
| Nishihara, JP | 14 |
| Instituto de Investigação Científica Tropicallocation not on record | 13 |
| LSF/FSA/UAClocation not on record | 13 |
| US | 13 |
| LDlocation not on record | 12 |
| TAIElocation not on record | 12 |
| Wuhan, CN | 12 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 11 |
| NSMKlocation not on record | 11 |
| Tomioka, JP | 11 |
| KURAlocation not on record | 10 |
| Université du Lomélocation not on record | 9 |
| Adam Mickiewicz University in Poznańlocation not on record | 9 |
| KOMlocation not on record | 9 |
| Yaoundé, CM | 9 |
| Hangzhou, CN | 9 |
| Osaka, JP | 8 |
| Zhejiang Universitylocation not on record | 8 |
| Armidale, AU | 8 |
| Jackson, US | 8 |
| Honolulu, US | 8 |
| Nishihara, JP | 8 |
| WAGlocation not on record | 7 |
| Changsha, CN | 7 |
| Seoul, KR | 7 |
| University of Stellenboschlocation not on record | 7 |
| Universidad Católica de Santa Maríalocation not on record | 7 |
| Peking Universitylocation not on record | 6 |
| Nanjing, CN | 6 |
| Wuzhou, CN | 6 |
| Anhui Normal Universitylocation not on record | 6 |
| EFGlocation not on record | 6 |
| Porto Alegre, BR | 6 |
| Uppsala, SE | 6 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 6 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 6 |
| Nagasaki University - Fisherieslocation not on record | 6 |
| Mississippi State, US | 6 |
| GMBAlocation not on record | 6 |
| Yunnan Universitylocation not on record | 6 |
| Plocation not on record | 5 |
| Awka, NG | 5 |
| KR | 5 |
| CNF-UFHBlocation not on record | 5 |
| Hobart, AU | 5 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 5 |
| Zhengzhou, CN | 5 |
| Xinxiang, CN | 5 |
| nlocation not on record | 5 |
| James Cook Townsvillelocation not on record | 5 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 5 |
| Miami, US | 5 |
| Columbia, US | 5 |
| Minia, EG | 4 |
| Kagoshima, JP | 4 |
| Taipei, TW | 4 |
| Moscow State Universitylocation not on record | 4 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 4 |
| Edinburgh, GB | 4 |
| Chengdu, CN | 4 |
| Little Rock, US | 4 |
| Xian, CN | 4 |
| Ishikawa Museum of Natural Historylocation not on record | 4 |
| Clemson, US | 4 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 4 |
| GAlocation not on record | 3 |
| Guiyang, CN | 3 |
| Valdosta State Universitylocation not on record | 3 |
| Gujarat Biodiversity Gene Banklocation not on record | 3 |
| Northeastern Forestry Universitylocation not on record | 3 |
| Pondicherry, IN | 3 |
| Strecker Museum, Baylor Universitylocation not on record | 3 |
| Nagatoro-machi, Chichibu-gun, JP | 3 |
| Sagamihara, JP | 3 |
| Tuscaloosa, US | 3 |
| Cambridge, US | 3 |
| Monastir, TN | 3 |
| Auckland, NZ | 3 |
| BISHlocation not on record | 3 |
| EL PASO, US | 3 |
| Akita Prefectural Museumlocation not on record | 3 |
| BAYLUlocation not on record | 3 |
| Jishou Universitylocation not on record | 2 |
| Williamsburg, US | 2 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 2 |
| Jiangxi Universitylocation not on record | 2 |
| Fayetteville, US | 2 |
| Shanghai, CN | 2 |
| BGPAlocation not on record | 2 |
| Zhuzhou, CN | 2 |
| Servico de Microbiologia e Imunologialocation not on record | 2 |
| Philadelphia, US | 2 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 2 |
| Kyoto Universitylocation not on record | 2 |
| Chongqing Natural History Museumlocation not on record | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| Bangkok, TH | 2 |
| University of Southern Mississippilocation not on record | 2 |
| H. Balslevlocation not on record | 2 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| Berlin, DE | 2 |
| Chongqing Museumlocation not on record | 2 |
| Austin, US | 2 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 2 |
| Central China Normal Universitylocation not on record | 2 |
| Port Elizabeth Museum (Bayworld)location not on record | 2 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 1 |
| CJBGlocation not on record | 1 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Ann Arbor, US | 1 |
| Dehra Dun, IN | 1 |
| Wellington, NZ | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| Chaguaramas, TT | 1 |
| Riverside, US | 1 |
| Glocation not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Durban, ZA | 1 |
| Cape Town, ZA | 1 |
| Leiden University Medical Centerlocation not on record | 1 |
| AUAlocation not on record | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Chengdu, CN | 1 |
| Université National du Béninlocation not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Henderson State Universitylocation not on record | 1 |
| LSFlocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Phoenix, US | 1 |
| Centre National des Semences Forestièreslocation not on record | 1 |
| Guiyang, CN | 1 |
| ENTClocation not on record | 1 |
| Mexico City, MX | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| SJNAlocation not on record | 1 |
| Burlington, US | 1 |
| Université de Strasbourglocation not on record | 1 |
| BRLUlocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Knoxville, US | 1 |
| UNICAMPlocation not on record | 1 |
| KIWElocation not on record | 1 |
| San Diego, US | 1 |
| Stockholm, SE | 1 |
| Christchurch, NZ | 1 |
| Baroda, IN | 1 |
| Elocation not on record | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Cincinnati, US | 1 |
| UFPRlocation not on record | 1 |
| CASlocation not on record | 1 |
| Shenzhen, CN | 1 |
| Guangxi Agricultural Universitylocation not on record | 1 |
| South Kensington, GB | 1 |
| Xian, CN | 1 |
| FJFClocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Zhejiang Museum of Natural Historylocation not on record | 1 |
| SIHUlocation not on record | 1 |
| KIRMlocation not on record | 1 |
| Edmonton, CA | 1 |
| Otaru, JP | 1 |
| F. Kontalocation not on record | 1 |
| MAlocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
216 institutions · 3 047 of 3 276 vouchered records shown · 226 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA19 detections
Where the DNA of Aeschynomene indica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found19
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 19 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.1 °C 21.5–25.7
Seasonal swing summer↔winter8.00 °C
Max temp (day)30.2 °C 27.7–31.6
Min temp (night)17.9 °C 16.1–20.2
Precipitation80.7 mm/mo 5.20–101
Air humidity51.9 % 47.4–55.6
Moisture balance-59.8 mm/mo -117–-28.9
Vapour deficit1,545 Pa 1,149–1,670
Wind speed2.10 m/s 1.80–2.40
Cloud cover18.2 % 5.70–46.4
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.