Aeschynomene aspera

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Aeschynomene

At a glance

Occurrence records168

Data sources12

Biological traits27

DNA specimens4

eDNA detections4

Sources12 archives

Databases and archives Aeschynomene aspera's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility168 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF168 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Rút nhám, rút dại hay điền ma nhám là một loài thực vật có hoa thủy sinh thuộc họ Fabaceae. Ruột cây rút nhám rất xốp và nhẹ, có tính cách nhiệt nên được dùng làm cốt mũ và nón, nhất là loại mũ mà tiếng Việt thường gọi là Mũ cối. Bản địa của cây rút nhám là Bangladesh, Bhutan, Campuchia, Ấn Độ, Indonesia, Lào, Malaysia, Myanmar, Malaysia, Nepal, Pakistan, Sri Lanka, Thái Lan, and Việt Nam. Cây rút mọc hoang ở những vùng đất trũng, ven ao hồ, ruộng ngập kể cả vùng nước lợ.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology7

Fruit length45 mm

Fruit width8.5 mm

Leaf length9 mm

Leaf width2.5 mm

Plant height2 m

Seed length7.5 mm

Seed width4.5 mm

Life cycle & reproduction7

Flowering timenyyyynnnnnnn

Life formannual, perennial or subshrub

Life spanannual

Raunkiær life formtherophyte

Reproductive maturity1 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticaquatic

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: shrub

Leaf compoundnesscompound

Leaf shapenarrowly_oblong oblong obovate

Woodinesswoody

⚠ sources differ — AusTraits: woody · GIFT: non-woody

Physiology & chemistry1

Nitrogen fixingnitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeschynomene aspera has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences8

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSFM242623.1 ↗614 bpSri Lanka

ACGT

ATCTAGCTAGACCTGCGAATGCGTTAACTCACCTGGGGCTGTTGCGGCTGCGTCGATAGCCTGCTTCCCCAAACAACCGGGGCGTGGCCC …

Aeschynomene aspera ITS1, 5.8S rRNA gene and ITS2, specimen voucher IRRI No 13020

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aeschynomene aspera carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records36–402n range38median40mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 382×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.

CCDB · book-ipcn75-78 — Sharma 1970

2n 402×CCDB · ipcn-api-dl · CCDB · book-indian_vol1

CCDB · ipcn-api-dl — Bairiganjan, G. C. & S. N. Patnaik. 1989. Chromosomal evolution in Fabaceae. Cytologia 54: 51–64.

CCDB · book-indian_vol1 — Sanjappa, M. & Sathyananda, N. 1979

2n 361×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Srivastava, M.G. 1959

n 203×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA, U. Chatterjee & D. Hazra. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 576–579.

CCDB · ipcn-api-dl — Bairiganjan, G. C. & S. N. Patnaik. 1989. Chromosomal evolution in Fabaceae. Cytologia 54: 51–64.

CCDB · ipcn-api-dl — Sanjappa, M. 1979a. In IOPB chromosome number reports LXIV. Taxon 28: 393–395.

n 192×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.

CCDB · book-ipcn75-78 — Sharma 1970

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type168 records

Wild obs. + sensor76

Museum / vouchered90

Other2

Origin

Native9

Introduced1

Range

Area of Occupancy AOO416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 8≤1 km 2≤10 km 1>10 km 1

12 georeferenced · 64 without coordinates

Open the mapobservation + sensor76

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 14≤1 km 9≤10 km 46>10 km 1

70 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence90

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	28
Brisbane, AU	17
Museo Entomologico de Leonlocation not on record	14
Smithfield, AU	6
Mount Annan, AU	5
Canberra, AU	5
Xiamen, CN	2
Herbarium of the Department of Botany, University of Tokyolocation not on record	2
Kew, GB	1
Yaoundé, CM	1
Hobart, AU	1
Monastir, TN	1
Armidale, AU	1
Saint Louis, US	1
Uppsala, SE	1
SNJB's KKHA Arts, SMGL Commerce & SPHJ Science College Chandwad, Dist. Nashik, Maharashtra, India. 423101.location not on record	1

16 institutions · 87 of 90 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Aeschynomene aspera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.7–25.7

Seasonal swing summer↔winter3.80 °C

Max temp (day)29.7 °C

Min temp (night)22.1 °C

Precipitation130 mm/mo

Air humidity64.2 %

Moisture balance-47.1 mm/mo

Vapour deficit1,194 Pa

Wind speed5.60 m/s

Cloud cover40.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)