Aerva javanica

(Burm.fil.) Juss. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Aerva

At a glance

Occurrence records1 641

Data sources12

Biological traits38

DNA specimens57

eDNA detections39

Sources12 archives

Databases and archives Aerva javanica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 641 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources38 traits

Chemical compositionLOTUS · NPASS13 compounds

Occurrence & distributionGBIF1 641 records

Environmental DNA1 datasets · 7 countries39 detections

DNA & barcodingBOLD · NCBI57 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Aerva javanica, the kapok bush or desert cotton, is a species of plant in the family Amaranthaceae. It has a native distribution incorporating much of Africa (including Madagascar), and the south-west and south of Asia, and it has become adventitious in northern Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology13

Fruit length1.5 mm

Leaf length17.5 mm

Leaf length max70 mm

Leaf length min20 mm

Leaf size300 mm²

Leaf width9 mm

Plant height1.5 m

⚠ sources differ — GIFT: 1.5 m · AusTraits: 1 m · TRY: 0.8 m

Plant height max1.6 m

Plant height min0.3 m

Seed length0.85 mm

Seed mass0.275 mg

⚠ sources differ — TRY: 0.275 mg · AusTraits: 0.275 mg · GIFT: 0.342 mg

Seed mass max0.984 mg

Seed mass min0.17 mg

Life cycle & reproduction9

Dispersal typewind

Flowering endMar

Flowering startFeb

Life formsubshrub

Life spanperennial

Pollination syndromeinsect+wind

Raunkiær life formchamaephyte

Self fertilizationabsent

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 500 m

Elevation min600 m

Epiphyteterrestrial

Fruit typeutricle

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: herb

Habitat GIFTvegetated beaches

Leaf compoundnesssimple

Leaf shapelinear narrowly_obovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

03Chemical composition13 compounds

Compounds documented for Aerva javanica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavonols8

Flavones3

Flavanones1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
3-[(2S,5S)-4,5-dihydroxy-6-[[(2R,3S,5R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxy-5,7-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)chromen-4-one	present	LOTUS
5,7-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-3-[(3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	LOTUS
5,7-dihydroxy-2-(4-hydroxyphenyl)-3-[(3R,4S,5R,6R)-3,4,5-trihydroxy-6-[(1R,2S,3R,4R)-1,2,3,4-tetrahydroxypentyl]oxan-2-yl]oxychromen-4-one	present	LOTUS
7''-O-Methylsciadopitysin	present	NPASS
7-Hydroxy-2-(4-hydroxyphenyl)-8-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-2,3-dihydrochromen-4-one	present	LOTUS
[(2S,3R,4S,5R,6S)-6-[(2S,3R,4S,5S,6R)-6-(acetyloxymethyl)-2-[5,7-dihydroxy-2-(4-methoxyphenyl)-4-oxochromen-3-yl]oxy-4,5-dihydroxyoxan-3-yl]oxy-4,5-dihydroxy-2-methyloxan-3-yl] (E)-3-(4-hydroxy-3,5-dimethoxyphenyl)-2-methylprop-2-enoate	present	LOTUS
[(3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (E)-3-[4-[3,5-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-4-oxochromen-7-yl]oxyphenyl]prop-2-enoate	present	LOTUS
[6-[[6-[5,7-Dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-4-oxochromen-3-yl]oxy-3,4,5-trihydroxyoxan-2-yl]methoxy]-4,5-dihydroxy-2-methyloxan-3-yl] 3-(4-hydroxyphenyl)prop-2-enoate	present	LOTUS
CFPJAFNVQKSAMP-KAYWLYCHSA-N	present	NPASS
Heveaflavone	present	NPASS

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aerva javanica has left across the world's sequence archives.

At a glance

DNA specimens57

Marker genes5

GenBank sequences10

eDNA detections39

Countries8

The DNA barcodea real sequence read deposited for this species

ITSOQ458804.1 ↗443 bpSaudi Arabia · 2016

ACGT

ATGCGGTTTTTCTGTGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCAGGGCAC …

Aerva javanica voucher F116 (UQU) 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aerva javanica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 361×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Pal, M. 1964

n 161×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 641 records

Wild obs. + sensor1 383

Museum / vouchered239

Cultivated / captive3

Other16

Range

Area of Occupancy AOO3 796 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 415≤1 km 89≤10 km 80>10 km 56

640 georeferenced · 743 without coordinates

Open the mapobservation + sensor1 383

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 14≤1 km 43≤10 km 74>10 km 15

146 georeferenced · 93 without coordinates

Open the institutions mapphysical evidence239

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
QAUlocation not on record	103
GMBAlocation not on record	16
Uniwersytet Śląski w Katowicachlocation not on record	14
Moscow State Universitylocation not on record	8
IFAN Ch. A. Dioplocation not on record	7
Xiamen, CN	6
Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record	5
LDlocation not on record	5
Sharjah Seed Bank & Herbariumlocation not on record	4
University of Hargeisalocation not on record	4
Uppsala, SE	4
MAlocation not on record	3
Philadelphia, US	3
Bratislava, SK	3
Yaoundé, CM	2
Rishon Le Zion, IL	2
Frankfurt am Main	2
Bloomington, US	2
Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record	1
Davis, US	1
Tampa, US	1
Muzaffarabad, PK	1
Centre National des Semences Forestièreslocation not on record	1
University of Guelph, OAC Herbariumlocation not on record	1
University of Sindh Jamshorolocation not on record	1
Honolulu, US	1
University of Modern Sciences, Dubailocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
National Museums of Kenyalocation not on record	1
Beijing, CN	1
EL PASO, US	1

31 institutions · 206 of 239 vouchered records shown · 17 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA39 detections

Where the DNA of Aerva javanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map7 countries0

red soil

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.9 °C 14.6–27.9

Seasonal swing summer↔winter13.9 °C

Max temp (day)30.8 °C 19.4–33.3

Min temp (night)16.6 °C 8.20–19.6

Precipitation4.50 mm/mo 4.40–29.5

Air humidity44.0 % 40.4–55.7

Moisture balance-167 mm/mo -169–-54.1

Vapour deficit1,644 Pa 839–2,322

Wind speed2.80 m/s 2.20–3.20

Cloud cover14.0 % 9.40–41.1

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aerva javanica

At a glance

Sources12 archives

Size & morphology13

Life cycle & reproduction9

Diet & foraging1

Habitat & environment12

Physiology & chemistry2

Other traits1

Compound class profile3 classes

Documented compounds13 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 641 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 31 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 641 records