Aerides rosea

Lodd. ex Lindl. & Paxton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Aerides

At a glance

Occurrence records56

Data sources10

Biological traits10

DNA specimens5

eDNA detections5

Sources10 archives

Databases and archives Aerides rosea's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility56 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF56 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Aerides rosea is a species of epiphytic orchid. It is native to China (Guangxi, Guizhou, Yunnan), Assam, Bhutan, Cambodia, India, Laos, Myanmar, Thailand and Vietnam.Kew World Checklist of Selected Plant FamiliesFlora of China v 25 p 485, 多花指甲兰 duo hua zhi jia lan , Aerides rosea

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass0.069 mg

Life cycle & reproduction3

Life formepiphytic subshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Epiphyte

Woodinesswoody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aerides rosea has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences10

eDNA detections5

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMK120356.1 ↗696 bpBelgium · 2016

ACGT

ACCTGCGGAAGGATCATTGTCGAGACCGAAATTATATCGAGCGATTCGGAGAACCTGTGAAATAAGCGGCGGCGTCCGTCGCCGCGAAGC …

Aerides rosea voucher DS0012 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aerides rosea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidypolyploid inferred

Chromosome records38–382n range38median38mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 389×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol2 +2

CCDB · ipcn-api-dl — VIJ, S. P., N. Shekhar, R. Kuthiala & A. Sood. 1983. In: IOPB chromosome number reports LXXVIII. Taxon 32: 138.

CCDB · ipcn-api-dl — Sau, H. & A. K. Sharma. 1983. Chromosome evolution and affinity of certain genera of Orchidaceae. Cytologia 48: 363–372.

CCDB · ipcn-api-dl — Hegde, S. N. & R. S. Ingalhalli. 1985. Chromosome Number Reports LXXXVIII. Taxon 34: 547–551.

CCDB · book-ipcn67-71 — JONES, K. 1967. The chromosomes of Orchids: II Vandeae Lindl. Kew Bull. 21: 151-156.

CCDB · book-indian_vol2 — Jones, K. 1967

CCDB · book-indian_vol2 — Kamemoto, H. et al. 1964

CCDB · eflora

CCDB · book-fedorov — Kamemoto, Sagarik, Kasemsap 1964

CCDB · book-fedorov — I. 1964)

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type56 records

Wild obs. + sensor14

Museum / vouchered42

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤1 km 4≤10 km 2>10 km 5

11 georeferenced · 3 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 1

3 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	15
Guangzhou, CN	9
Kunming, CN	6
Saint Louis, US	3
Guilin, CN	2
Bronx, US	1
South Kensington, GB	1

7 institutions · 37 of 42 vouchered records shown · 5 without an institution code

09Environmental DNA5 detections

Where the DNA of Aerides rosea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)