Aerides maculosa

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Aerides

At a glance

Occurrence records124

Data sources9

Biological traits9

DNA specimens12

eDNA detections11

Sources9 archives

Databases and archives Aerides maculosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility124 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF124 records

Environmental DNA1 datasets · 0 countries11 detections

DNA & barcodingBOLD · NCBI12 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Aerides maculosa is a species of orchid endemic to India.Kew World Checklist of Selected Plant Families The epithet "maculosa" means "spotted," in reference to the colored spots on the tepals.Lindley, John. 1858. Edwards's Botanical Register 31: plate 58 + following text

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formepiphytic subshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climateseasonally dry tropical

Climberself-supporting

Epiphyteobligatory

Growth formherb

Woodinessnon-woody

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aerides maculosa has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes4

GenBank sequences10

eDNA detections11

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK120347.1 ↗538 bpIndia · 2016

ACGT

AGCTATCGACAAACACGGCCCGTCACCGGGTCTTCGTGGGGTGGAGCGGTGCTGCGCGCCGCGCGTACTGACACGACTCTCGACAGTGGA …

Aerides maculosa voucher DS003 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL6★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aerides maculosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidypolyploid inferred

Chromosome records38–382n range38median38mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 384×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol2

CCDB · ipcn-api-dl — Singh, F. 1981. ln Chromosome number reports LXXII. Taxon 30: 704–705.

CCDB · ipcn-api-dl — Kulkarni, H. & S. M. Jorapur. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 392.

CCDB · book-ipcn67-71 — JONES, K. 1967. The chromosomes of Orchids: II Vandeae Lindl. Kew Bull. 21: 151-156.

CCDB · book-indian_vol2 — Jones, K. 1967 ; Kulkarni, H. & Jorapur, S.M. 1979

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type124 records

Wild obs. + sensor115

Museum / vouchered9

Range

Area of Occupancy AOO392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 15≤1 km 24≤10 km 26>10 km 10

75 georeferenced · 40 without coordinates

Open the mapobservation + sensor115

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 1≤10 km 5

6 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Baroda, IN	5
Gujarat Biodiversity Gene Banklocation not on record	1
South Kensington, GB	1

3 institutions · 7 of 9 vouchered records shown · 2 without an institution code

09Environmental DNA11 detections

Where the DNA of Aerides maculosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)