Aerides falcata

Lindl. & Paxton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Aerides

At a glance

Occurrence records50

Data sources10

Biological traits9

DNA specimens2

eDNA detections3

Sources10 archives

Databases and archives Aerides falcata's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility50 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF50 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Aerides falcata is a species of epiphytic orchidLindley, John & Paxton, Joseph. 1851. Paxton's Flower Garden. Revised. 2: 142 native to Yunnan, Vietnam, Thailand, Laos, Cambodia, Myanmar.Kew World Checklist of Selected Plant FamiliesFlora of China v 25 p 486, 指甲兰 zhi jia lan , Aerides falcata

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formepiphytic subshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Epiphyte

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aerides falcata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections3

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKY745854.1 ↗266 bpChina · 2016

ACGT

AGCGTCGCGCCGCTCCGTGCCTAGTCCCCACCATCCCGCCGCAGTGGGGGTGCCGGACGAAGGCTCGGACGTGCAGAGTGGCTCGTCGTG …

Aerides falcata isolate vmt64 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL3★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aerides falcata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome records38–382n range38median38mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 384×CCDB · eflora · CCDB · book-fedorov

CCDB · eflora

CCDB · book-fedorov — Chardard 1963

CCDB · book-fedorov — Kamemoto, Sagarik, Kasemsap 1964

CCDB · book-fedorov — I. 1964)

n 191×CCDB · Cave1963

CCDB · Cave1963 — Chardard 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type50 records

Wild obs. + sensor28

Museum / vouchered22

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 6≤1 km 5≤10 km 1>10 km 10

22 georeferenced · 6 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 4≤10 km 2

6 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	4
Chongqing Museumlocation not on record	3
Moscow State Universitylocation not on record	2
Kunming, CN	1
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	1

5 institutions · 11 of 22 vouchered records shown · 11 without an institution code

09Environmental DNA3 detections

Where the DNA of Aerides falcata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)