Aeria eurimedia

(Cramer, 1779) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Aeria

At a glance

Occurrence records407

Data sources8

Biological traits0

DNA specimens51

eDNA detections50

Sources8 archives

Databases and archives Aeria eurimedia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility407 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF407 records

Environmental DNA1 datasets · 6 countries50 detections

DNA & barcodingBOLD51 specimens

Genome at a glanceGoaT2n = 38

01Narrative

Aeria eurimedia is a species of butterfly of the family Nymphalidae. It is found in Central and northern South America. The larvae have been recorded feeding on Prestonia portabellensis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeria eurimedia has left across the world's sequence archives.

At a glance

DNA specimens51

BINs3

Marker genes4

eDNA detections50

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

5Tvariable

40Amostly conserved

97Cmostly conserved

181Amostly conserved

184Amostly conserved

217Gmostly conserved

220Cmostly conserved

235Cmostly conserved

238Tmostly conserved

316Amostly conserved

340Tmostly conserved

343Cmostly conserved

352Cmostly conserved

370Gmostly conserved

373Gvariable

379Gvariable

421Cmostly conserved

433Amostly conserved

478Tmostly conserved

479Tmostly conserved

530Cmostly conserved

541Amostly conserved

562Amostly conserved

574Tmostly conserved

589Tmostly conserved

628Avariable

634Tmostly conserved

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTCTAAGTTTATTAATCCGAACTGAATTAGGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes9

BINs3

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Godyris nerosame family7.3%Godyris dircennasame family7.3%Greta umbranasame family7.5%Pseudoscada pusiosame family7.6%Greta andromicasame family7.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5PEF1-alphaWnt1

animal barcodemarker

06Genome at a glanceGoaT

The complete instruction manual Aeria eurimedia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 381×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

08Occurrence & distribution

Record type407 records

Wild obs. + sensor324

Museum / vouchered83

Range

Area of Occupancy AOO872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 115≤1 km 99≤10 km 36>10 km 15

265 georeferenced · 59 without coordinates

Open the mapobservation + sensor324

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 6≤10 km 19>10 km 11

36 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence83

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	10
Universidad del Vallelocation not on record	9
New Haven, US	7
Caja de Compensación Familiar - Comfenalco Antioquialocation not on record	7
National Biodiversity Institute, Costa Ricalocation not on record	6
University Park, US	4
Natural History Museum of Utahlocation not on record	2
Universidad Nacional de Colombia (UNAL)location not on record	2
Brussels, BE	2
Universidad de Sucre (UniSucre)location not on record	1
Universidad Tecnológica del Chocó (UTCH)location not on record	1
RBINS-Scientific Heritagelocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1

13 institutions · 53 of 83 vouchered records shown · 17 without an institution code

09Environmental DNA50 detections

Where the DNA of Aeria eurimedia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map6 countries0

Forest1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 24.7–25.8

Seasonal swing summer↔winter1.00 °C

Max temp (day)27.4 °C 26.1–29.0

Min temp (night)23.5 °C 21.2–24.9

Precipitation333 mm/mo 209–430

Air humidity66.4 % 65.5–71.2

Moisture balance220 mm/mo

Vapour deficit1,056 Pa 910–1,111

Wind speed2.30 m/s

Cloud cover51.4 % 29.0–83.5

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)