Aequorea forskalea

Péron & Lesueur, 1810 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Hydrozoa/Leptothecata/Aequoreidae/Aequorea

At a glance

Occurrence records1 379

Data sources9

Biological traits4

DNA specimens14

eDNA detections115

Sources9 archives

Databases and archives Aequorea forskalea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility995 records↗

OBISOcean Biodiversity Information System384 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI115 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS1 379 records

Environmental DNA3 datasets · 2 countries115 detections

DNA & barcodingBOLD14 specimens

Genome at a glanceGoaT2n = 12

01Narrative

Aequorea forskalea is a species of hydrozoan in the family Aequoreidae. Discovered in 1810 by Péron and Lesueur, A. forskalea was initially found in coastal to offshore waters of the Mediterranean Sea. This species is commonly referred to as the many-ribbed jellyfish. The species is often mixed up with some other members of the genus due to some similarities including the capability of bioluminescence.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length8 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Other traits1

Vulnerability10

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aequorea forskalea has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes3

eDNA detections115

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

79Amostly conserved

82Cvariable

TACATTATATATTGTTTTTGGGGCTTTTTCAGGAATGGTAGGTACTGCTTTAAGTATGTTAATAAGACTAGAATTAGCAGGCCCAGGTCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.13%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Parateclaia norvegicasame order12.8%Cyclocanna productasame order13.1%Earleria paniculasame order13.2%Clytia folleatasame order13.5%Obelia dichotomasame order14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Aequorea forskalea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 121×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type1 379 records

Wild obs. + sensor1 170

Museum / vouchered141

Other68

Origin

Native8

Range

Area of Occupancy AOO2 368 km²

Depth

0–200 m sunlit204

200–1000 m twilight4

1–4 km midnight0

>4 km abyssal1

median 0 m · max 4 976 m · 209 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 288≤1 km 168≤10 km 165>10 km 4

625 georeferenced · 545 without coordinates

Open the mapobservation + sensor1 170

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 1≤1 km 22≤10 km 9>10 km 24

56 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence141

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	12
Brussels, BE	9
Barcelona, ES	8
RBINS-Scientific Heritagelocation not on record	7
ISTPM (Ifremer Nantes)location not on record	6
Santa Barbara Museum of Natural Historylocation not on record	6
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	5
Edmonton, CA	5
CASlocation not on record	3
New Haven, US	2
DASSHlocation not on record	1
Toronto, CA	1
	1
Royal British Columbia Museumlocation not on record	1
PNHSlocation not on record	1

15 institutions · 68 of 141 vouchered records shown · 2 without an institution code

09Environmental DNA115 detections

Where the DNA of Aequorea forskalea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found115

Studies independent surveys3

Countries2

Verifiable raw sequence linked114

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 115 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.60 °C -2.80–19.1

Seasonal swing summer↔winter26.4 °C

Max temp (day)12.6 °C 0.9–23.2

Min temp (night)7.80 °C -6.10–16.4

Precipitation106 mm/mo 89.3–129

Air humidity61.5 % 58.7–65.7

Moisture balance12.5 mm/mo -48.3–89.6

Vapour deficit457 Pa 197–824

Wind speed4.70 m/s 3.90–5.80

Cloud cover51.7 % 45.8–63.5

CHELSA 1981–2010, ~9 km grid, at location & month of 114 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aequorea forskalea

At a glance

Sources9 archives

Size & morphology1

Habitat & environment2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 379 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 379 records