Aequorea australis

Uchida, 1947 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Hydrozoa/Leptothecata/Aequoreidae/Aequorea

At a glance

Occurrence records1 163

Data sources6

Biological traits4

DNA specimens18

eDNA detections565

Sources6 archives

Databases and archives Aequorea australis's data was compiled from.

GBIFGlobal Biodiversity Information Facility571 records↗

OBISOcean Biodiversity Information System592 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI565 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS1 163 records

Environmental DNA2 datasets · 2 countries565 detections

DNA & barcodingBOLD18 specimens

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length2.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Other traits1

Vulnerability10

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aequorea australis has left across the world's sequence archives.

At a glance

DNA specimens18

BINs2

Marker genes2

eDNA detections565

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P602 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

1Avariable

8Cmostly conserved

26Avariable

74Amostly conserved

164Cmostly conserved

191Tmostly conserved

194Amostly conserved

275Amostly conserved

368Tmostly conserved

374Cmostly conserved

377Tmostly conserved

389Tmostly conserved

404Gmostly conserved

419Tmostly conserved

476Cmostly conserved

491Tmostly conserved

528Tmostly conserved

530Gmostly conserved

536Amostly conserved

539Cmostly conserved

557Tmostly conserved

581Cmostly conserved

596Cmostly conserved

599Cmostly conserved

ATATTGTCTTTGGTGCATTTTCTGGAATGGTAGGTACAGCCTTAAGTATGTTAATCAGATTAGAATTAGCTGGACCTGGTCCTATGTTTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.93%

Haplotypes7

BINs2

Most divergent pair3.5%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Parateclaia norvegicasame order12.3%Clytia folleatasame order12.6%Aequorea vitrinasame genus12.8%Eirene pyramidalissame order12.8%Aequorea neocyaneasame genus13.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 163 records

Wild obs. + sensor77

Museum / vouchered1 086

Range

Area of Occupancy AOO324 km²

Depth

0–200 m sunlit29

200–1000 m twilight1

1–4 km midnight2

>4 km abyssal0

median 100 m · max 2 000 m · 32 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 66

67 georeferenced · 10 without coordinates

Open the mapobservation + sensor77

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤1 km 8≤10 km 1

9 georeferenced · 1 077 without coordinates

Open the institutions mapphysical evidence1 086

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	3
Western Australian Museumlocation not on record	3
Brussels, BE	2
RBINS-Scientific Heritagelocation not on record	2
Sydney, AU	1

5 institutions · 11 of 1 086 vouchered records shown · 519 without an institution code

09Environmental DNA565 detections

Where the DNA of Aequorea australis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found565

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 565 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature26.0 °C 0–32.2

pH8.03 8.00–8.23

Conductivity54,068 µS/cm 1,783–61,832

Salinity35.3 PSU 0.908–36.4

Dissolved oxygen7.24 mg/L 4.50–9.16

Turbidity0.345 NTU 0.002–73.0

Nitrate0.3 µmol/L 0.1–13.9

Depth10.0 m 0–2,200

PelagicSedimentCoastal water

545 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 16.1–27.2

Seasonal swing summer↔winter6.20 °C

Max temp (day)24.6 °C 17.8–29.0

Min temp (night)22.6 °C 14.5–26.2

Precipitation88.1 mm/mo 18.5–283

Air humidity60.5 % 56.4–63.4

Vapour deficit1,162 Pa 778–1,416

Cloud cover32.2 % 19.7–57.1

CHELSA 1981–2010, ~9 km grid, at location & month of 547 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aequorea australis

At a glance

Sources6 archives

Size & morphology1

Habitat & environment2

Other traits1

At a glance

Record type1 163 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type1 163 records