Aequidens pallidus

(Heckel, 1840) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Cichlidae/Aequidens

At a glance

Occurrence records258

Data sources7

Biological traits5

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Aequidens pallidus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility258 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF258 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Aequidens pallidus est une espèce de poissons perciformes appartenant à la famille des Cichlidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length14.3 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importancecommercial

Other traits1

Vulnerability10

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aequidens pallidus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P426 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

33Cvariable

45Cvariable

93Avariable

102Cvariable

120Avariable

132Cvariable

153Tmostly conserved

156Avariable

186Avariable

198Cvariable

201Avariable

210Cvariable

216Avariable

234Cvariable

237Gmostly conserved

243Avariable

249Cvariable

288Avariable

303Cvariable

336Cvariable

342Avariable

384Cmostly conserved

397Cvariable

405Avariable

411Cvariable

423Avariable

ATAATTTTCTTTATGGTAATACCCATCATAATCGGAGGCTTCGGCAATTGACTAATTCCACTAATAATTGGCGCCCCTGACATAGCCTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.0%

Haplotypes3

BINs0

Most divergent pair5.9%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aequidens diademasame genus4.2%Aequidens michaelisame genus11.5%Aequidens tetramerussame genus12.4%Cichlasoma portalegrensesame family12.7%Cichlasoma dimerussame family13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type258 records

Wild obs. + sensor12

Museum / vouchered246

Range

Area of Occupancy AOO704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 3≤1 km 5≤10 km 2

10 georeferenced · 2 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 6

6 georeferenced · 240 without coordinates

Open the institutions mapphysical evidence246

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	181
Museu de Zoologia da Universidade de Sao Paulolocation not on record	38
Museu Paraense Emílio Goeldilocation not on record	7
UNICAMPlocation not on record	5
CASlocation not on record	4
Londrina, BR	3
Stockholm, SE	2
Pontificia Universidad Javeriana (PUJ)location not on record	2
UEMlocation not on record	1
Frankfurt am Main	1

10 institutions · 244 of 246 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Aequidens pallidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter2.20 °C

Max temp (day)30.2 °C

Min temp (night)21.3 °C

Precipitation164 mm/mo

Air humidity64.0 %

Moisture balance32.9 mm/mo

Vapour deficit1,154 Pa

Wind speed1.10 m/s

Cloud cover45.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)