Aequatorium jamesonii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Aequatorium

At a glance

Occurrence records63

Data sources5

Biological traits10

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Aequatorium jamesonii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility63 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF63 records

DNA & barcodingNCBIsequences

01Narrative

Aequatorium jamesonii là một loài thực vật có hoa thuộc họ Asteraceae. Loài này chỉ có ở Ecuador. Môi trường sống tự nhiên của chúng là vùng núi ẩm nhiệt đới hoặc cận nhiệt đới. Chúng hiện đang bị đe dọa vì mất môi trường sống.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology1

Plant height max15 m

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max4 000 m

Elevation min2 800 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aequatorium jamesonii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

rbcLNC_062445.1 ↗151 010 bp

ACGT

TGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGCTTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCCTCTACTATTAT …

Aequatorium jamesonii isolate SEN195 voucher B:DB38638 plastid, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL2

plant barcode

08Occurrence & distribution

Record type63 records

Wild obs. + sensor29

Museum / vouchered34

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 29 records without

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤1 km 2≤10 km 6

9 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad Nacional de Colombia (UNAL)location not on record	10
Saint Louis, US	4
University of Stellenboschlocation not on record	4
Xiamen, CN	3
QCNElocation not on record	3
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	2
HFEBGlocation not on record	1
Quito, EC	1
Uppsala, SE	1

9 institutions · 29 of 34 vouchered records shown · 5 without an institution code