Aeonium sedifolium

(Webb ex Bolle) Pit. & Proust · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Aeonium

At a glance

Occurrence records124

Data sources11

Biological traits27

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Aeonium sedifolium's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility124 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF124 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT660 Mbp

01Narrative

Aeonium sedifolium is a perennial flowering plant in the stonecrop family Crassulaceae. The plant is native to the western Canary Islands of Tenerife, La Gomera and La Palma.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Inflorescence length max7.0 cm

Inflorescence length min2 cm

Leaf length max15 mm

Leaf length min7 mm

Leaf width max10 mm

Leaf width min4 mm

Plant height max0.4 m

Plant height min0.15 m

Life cycle & reproduction8

Deciduousnessevergreen

Flower colouryellow

Flower length max7 mm

Flower length min5 mm

Flowering endJun

Flowering startMar

Life formsucculent subshrub

Life spanperennial

Habitat & environment7

Climatesubtropical

Elevation max1 000 m

Elevation min100 m

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: succulent

Leaf formobovate

Succulenceyes

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: woody

Physiology & chemistry1

Photosynthetic pathwayCAM

Other traits3

Leaf arrangementrosette

Leaf thickness max5 mm

Leaf thickness min3 mm

03Chemical composition4 compounds

Compounds documented for Aeonium sedifolium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols4

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
Jaranol	present	LOTUS
Kaempferol-7,4'-dimethyl ether	present	LOTUS
Myricetin 3,7,4'-trimethyl ether	present	LOTUS
Myricetin 7,3',4'-trimethyl ether	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeonium sedifolium has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF209834.1 ↗209 bp

ACGT

TCGNGCCTAGACAGCACGACCGCGAATGAGTTGCTAATTGCAGCGACGGGTAACTGCTCGCTGCCGTTTCTAGTTTGTGGGGGGGCCTAG …

Aeonium sedifolium internal transcribed spacer 1, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Aeonium sedifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size660 150 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aeonium sedifolium0.66 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidy4× tetraploid · measured

Chromosome records36–362n range36median36mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 363×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Liu, H. y. 1989. Systematics of Aeonium (Crassulaceae). Special Publ. Natl. Mus. Nat. Sci. 3.

CCDB · kew — Suda J, Kyncl T, Jarolimova V. 2005. Genome size variation in Macaronesian angiosperms: forty percent of the Canarian endemic flora completed. Plant Systematics and Evolution 252: 215-238.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type124 records

Wild obs. + sensor116

Museum / vouchered7

Cultivated / captive1

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 41≤1 km 13≤10 km 53

107 georeferenced · 9 without coordinates

Open the mapobservation + sensor116

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2≤10 km 1

3 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence7

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	1
Saint Louis, US	1
Christchurch, NZ	1
Frankfurt am Main	1
BClocation not on record	1
College of the Atlantic, Museumlocation not on record	1

6 institutions · 6 of 7 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Aeonium sedifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)