Aeonium lancerottense

(Praeger) Praeger · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Aeonium

At a glance

Occurrence records384

Data sources7

Biological traits22

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Aeonium lancerottense's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility384 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF384 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

miniatur|Blütenstand Aeonium lancerottense ist eine Pflanzenart aus der Gattung Aeonium in der Familie der Dickblattgewächse (Crassulaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Inflorescence length max30 cm

Inflorescence length min8 cm

Leaf length max90 mm

Leaf length min50 mm

Leaf width max40 mm

Leaf width min15 mm

Plant height max0.6 m

Seed mass0.166 mg

Life cycle & reproduction6

Flower colourpink

Flower length max9 mm

Flower length min6 mm

Flowering endJul

Flowering startMar

Life formsucculent subshrub

Habitat & environment4

Climatesubtropical

Elevation max600 m

Elevation min200 m

Leaf formelliptic

Other traits4

Leaf arrangementrosette

Leaf thickness max6 mm

Leaf thickness min3 mm

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeonium lancerottense has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSAF209825.1 ↗208 bp

ACGT

TCGNGCCTAGAAAGCACGACCGCGAATGAGTTGCTAATTGCAGCGACGGGTAACCGCTCGCTGCCCTTTCTGGTTTGCGGGGGGCCTAGC …

Aeonium lancerottense internal transcribed spacer 1, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aeonium lancerottense carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Liu, H. y. 1989. Systematics of Aeonium (Crassulaceae). Special Publ. Natl. Mus. Nat. Sci. 3.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type384 records

Wild obs. + sensor381

Museum / vouchered3

Range

Area of Occupancy AOO360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 173≤1 km 48≤10 km 57>10 km 9

287 georeferenced · 94 without coordinates

Open the mapobservation + sensor381

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Universidad del Pais Vasco (UPV/EHU)location not on record	1
ESP003location not on record	1
MAlocation not on record	1

3 institutions · 3 of 3 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)