Aeonium hierrense

(R.P.Murray) Pit. & Proust · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Aeonium

At a glance

Occurrence records169

Data sources7

Biological traits25

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Aeonium hierrense's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility169 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF169 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Aeonium hierrense is a species of succulent flowering plant in the family Crassulaceae that is endemic to the island of El Hierro in the Canary islands. It has whorls of strongly ciliate leaves borne on a stem up to 1m in height. The leaves takes on an attractive purple colour during the summer, being quite green in the winter. It produces whitish pink flowers that have 8-fold symmetry.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Leaf length max300 mm

Leaf length min100 mm

Leaf width max80 mm

Leaf width min50 mm

Plant height max1 m

Plant height min0.3 m

Life cycle & reproduction7

Deciduousnessevergreen

Flower colourpink

Flower length max9 mm

Flower length min7 mm

Flowering endMay

Flowering startApr

Life formsucculent subshrub

Habitat & environment7

Climatesubtropical

Elevation max1 000 m

Elevation min50 m

Growth formsucculent

Leaf formlanceolate

Succulenceyes

Woodinessvariable

Physiology & chemistry1

Photosynthetic pathwayCAM

Other traits4

Leaf arrangementrosette

Leaf thickness max7.5 mm

Leaf thickness min3.5 mm

Shoot orientationerect

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeonium hierrense has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSAF209853.1 ↗208 bp

ACGT

TCGNGCCTAGAAAGCACGACCGCGAATGAGTTGCTAATTGCAGCGACGGGCGACCGCTCGCTGCCCTTTCTAGTTTGTGGGGGGCCTAGC …

Aeonium hierrense internal transcribed spacer 1, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aeonium hierrense carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Liu, H. y. 1989. Systematics of Aeonium (Crassulaceae). Special Publ. Natl. Mus. Nat. Sci. 3.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type169 records

Wild obs. + sensor166

Museum / vouchered2

Fossil1

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 28≤1 km 101≤10 km 17>10 km 5

151 georeferenced · 15 without coordinates

Open the mapobservation + sensor166

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	1

1 institutions · 1 of 2 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)