Aeonium haworthii

Salm-Dyck ex Webb & Berthel. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Aeonium

At a glance

Occurrence records807

Data sources11

Biological traits49

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Aeonium haworthii's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility807 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources49 traits

Occurrence & distributionGBIF807 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT758 Mbp

01Narrative

Aeonium haworthii, also known as Haworth's aeonium or pinwheel, is a species of succulent flowering plant in the family Crassulaceae. It is grown as a houseplant in temperate regions. It has gained the Royal Horticultural Society's Award of Garden Merit, as has the cultivar 'Variegatum'.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology16

Inflorescence length max16 cm

Inflorescence length min6 cm

Leaf length37.5 mm

Leaf length max80 mm

Leaf length min35 mm

Leaf width18 mm

⚠ sources differ — AusTraits: 18 mm · GIFT: 30 mm

Leaf width max30 mm

Leaf width min15 mm

Plant height0.4 m

⚠ sources differ — GIFT: 0.4 m · AusTraits: 0.75 m

Plant height max1 m

Plant height min0.2 m

Seed length0.625 mm

Seed length max0.6 mm

Seed length min0.6 mm

Seed mass0.071 mg

Seed width0.3 mm

Life cycle & reproduction13

Deciduousnessevergreen

Dispersal typeunspecialized

Flower colourpink

Flower length max9 mm

Flower length min7 mm

Flowering endMay

Flowering startApr

Life formsucculent subshrub

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproduction asexualpresent

Diet & foraging1

Parasiteindependent

Habitat & environment14

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Fruit typefollicle

Growth formshrub

Habitat GIFTCoastal

Leaf compoundnesssimple

Leaf formobovate

Leaf shapeobovate

Mycorrhizapresent

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · AusTraits: woody · GIFT: woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayCAM

Other traits3

Leaf arrangementrosette

Leaf thickness max4 mm

Leaf thickness min2.5 mm

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeonium haworthii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF209842.1 ↗209 bp

ACGT

TCGNGCCTAGAAAGCACGACCGCGAATGAGTTGCTAATTGCAGCGACGGGCGACCGCTCGCTGCCCTTTCTAGTTTGTGGGGGGCCTAGC …

Aeonium haworthii internal transcribed spacer 1, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3★ITS2

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Aeonium haworthii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size757 950 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aeonium haworthii0.76 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Ploidypolyploid inferred

Chromosome records72–722n range72median72mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 723×GoaT · Kew Plant DNA C-values Database · CCDB · eflora · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · eflora

CCDB · kew — Hanson L, McMahon KA, Johnson MAT, Bennett MD. 2001. First nuclear DNA C-values for 25 angiosperm families. Annals of Botany 87: 251-258

n 361×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Liu, H. y. 1989. Systematics of Aeonium (Crassulaceae). Special Publ. Natl. Mus. Nat. Sci. 3.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type807 records

Wild obs. + sensor660

Museum / vouchered135

Cultivated / captive5

Other7

Origin

Native8

Introduced50

Range

Area of Occupancy AOO1 260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 351≤1 km 83≤10 km 74>10 km 17

525 georeferenced · 135 without coordinates

Open the mapobservation + sensor660

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 13≤1 km 25≤10 km 8

46 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence135

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	42
Museo Entomologico de Leonlocation not on record	18
Auckland, NZ	14
Adelaide, AU	14
San Luis Obispo, US	5
BDBClocation not on record	4
San Diego, US	4
Hobart, AU	3
Claremont, US	3
Riverside, US	3
Kensington, AU	3
Canadian Department of Agriculturelocation not on record	3
BIO-UNIPIlocation not on record	3
Saint Louis, US	2
Canberra, AU	2
Irvine, US	1
San Diego Natural History Museumlocation not on record	1
MAlocation not on record	1
Wellington, NZ	1
Mount Annan, AU	1
CJBGlocation not on record	1
BClocation not on record	1
Rotorua, NZ	1

23 institutions · 131 of 135 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Aeonium haworthii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 17.6–17.6

Seasonal swing summer↔winter6.90 °C

Max temp (day)20.2 °C

Min temp (night)15.4 °C

Precipitation2.10 mm/mo

Air humidity65.8 %

Vapour deficit683 Pa

Cloud cover18.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)