Aeonium cuneatum

Webb & Berthel. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Aeonium

At a glance

Occurrence records336

Data sources10

Biological traits25

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Aeonium cuneatum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility336 records↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Chemical compositionNPASS39 compounds

Occurrence & distributionGBIF336 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Aeonium cuneatum is a succulent species of flowering plant in the family Crassulaceae. It has a large leaf rosette and no stem. The leaves are smooth but have a grey shine to the upper surface which can be rubbed. It offshoots easily which makes a large group of Aeoniums across the ground. The flower is yellow and more open than the flowers of some other Aeonium species. The Latin specific epithet cuneatum means "wedge-shaped;" this refers to the shape of the leaves.Flora Vascular de Canarias

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Inflorescence length max60 cm

Inflorescence length min18 cm

Leaf length max250 mm

Leaf length min100 mm

Leaf width max80 mm

Leaf width min50 mm

Plant height max1.2 m

Plant height min0.9 m

Life cycle & reproduction7

Flower colouryellow

Flower length max7.5 mm

Flower length min6.5 mm

Flowering endJun

Flowering startApr

Life formsucculent perennial or chamaephyte

Life spanperennial

Habitat & environment6

Climatesubtropical

Elevation max950 m

Elevation min500 m

Growth formherb

Succulenceyes

Woodinessnon-woody

Other traits4

Leaf arrangementrosette

Leaf thickness max9 mm

Leaf thickness min5 mm

Plant support typefree-standing

03Chemical composition39 compounds

Compounds documented for Aeonium cuneatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Naphthoquinones8

Stigmastane steroids4

Arylnaphthalene and aryltetralin lignans2

Lupane triterpenoids2

Simple phenolic acids1

Documented compounds39 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3aR,5aR,5bR,7aS,9S,11aR,11bR,13aR,13bR)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-ol	present	NPASS
(3R)-3-hydroxy-2,2-dimethyl-3,4-dihydrobenzo[g]chromene-5,10-dione	present	NPASS
(3S)-3-hydroxy-2,2-dimethyl-3,4-dihydrobenzo[g]chromene-5,10-dione	present	NPASS
2,6-Dimethoxy-1-acetonylquinol	present	NPASS
2-Methylanthraquinone	present	NPASS
3,3-Dimethyl-2,4-Dihydrobenzo[G]Chromene-5,10-Dione	present	NPASS
6beta-Hydroxystigmast-4-en-3-one	present	NPASS
[(3R)-2,2-dimethyl-5,10-dioxo-3,4-dihydrobenzo[g]chromen-3-yl] (2E,6E)-2,6-dimethylocta-2,6-dienoate	present	NPASS
[(3R)-2,2-dimethyl-5,10-dioxo-3,4-dihydrobenzo[g]chromen-3-yl] (2E,6S)-6-hydroxy-2,6-dimethylocta-2,7-dienoate	present	NPASS
[(3R)-2,2-dimethyl-5,10-dioxo-3,4-dihydrobenzo[g]chromen-3-yl] (E)-5-[(2R,3R)-2,3-dimethyloxiran-2-yl]-2-methylpent-2-enoate	present	NPASS

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeonium cuneatum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

The DNA barcodea real sequence read deposited for this species

ITSAF209841.1 ↗209 bp

ACGT

TCGNGCCTAGAAAGCACGACCGCGAATGAGTTGCTAATTGCTGCGACGGGTAACCGCTCGCTGCCCTTTCTAGTTTGTGGGGGGCCTAGC …

Aeonium cuneatum internal transcribed spacer 1, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aeonium cuneatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome records36–362n range36median36mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 362×CCDB · nw-europe-fl · CCDB · ipcn-api-dl

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2516

CCDB · ipcn-api-dl — Liu, H. y. 1989. Systematics of Aeonium (Crassulaceae). Special Publ. Natl. Mus. Nat. Sci. 3.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type336 records

Wild obs. + sensor332

Museum / vouchered4

Origin

Introduced13

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy32% within 1 km

≤100 m 74≤1 km 24≤10 km 198>10 km 15

311 georeferenced · 21 without coordinates

Open the mapobservation + sensor332

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
ESP003location not on record	1
JBSlocation not on record	1

2 institutions · 2 of 4 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)