Aeonium aureum

(C.Sm. ex Hornem.) T.H.M.Mes · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Aeonium

At a glance

Occurrence records261

Data sources7

Biological traits23

DNA specimens5

eDNA detections5

Sources7 archives

Databases and archives Aeonium aureum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility261 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF261 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Aeonium aureum is a species of flowering plant in the family Crassulaceae, native to the Canary Islands (Tenerife, Gran Canaria, El Hierro, La Gomera and La Palma). It has very short stems, usually with several leaf rosettes. The grey-green leaves are tightly packed and fleshy. The bright yellow flowers are produced on leafy stems, and are up to across. Leaf rosettes

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Inflorescence length max40 cm

Leaf length max90 mm

Leaf length min50 mm

Leaf width max45 mm

Leaf width min25 mm

Plant height max0.45 m

Plant height min0.3 m

Life cycle & reproduction7

Flower colouryellow

Flower width max25 mm

Flower width min20 mm

Flowering endJun

Flowering startMar

Life formsucculent perennial

Life spanperennial

Habitat & environment7

Climatesubtropical

Elevation max2 000 m

Elevation min400 m

Growth formherb

Leaf formspatulate

Succulenceyes

Woodinessnon-woody

Other traits2

Leaf arrangementrosette

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeonium aureum has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAF209832.1 ↗207 bp

ACGT

TCGNGCCTAGAAAGCACGACCGCGAATGAGTTGCTAATTGCAGTGACGGGTAACCGCTCGCTGCCTTTCTAGTTTGTGGGGGGTCTAGCA …

Greenovia aurea internal transcribed spacer 1, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★rbcLa★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type261 records

Wild obs. + sensor256

Museum / vouchered4

Fossil1

Range

Area of Occupancy AOO464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 157≤1 km 28≤10 km 11>10 km 2

198 georeferenced · 58 without coordinates

Open the mapobservation + sensor256

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Alexandria Universitylocation not on record	1

1 institutions · 1 of 4 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Aeonium aureum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 15.5–17.9

Seasonal swing summer↔winter16.4 °C

Max temp (day)20.7 °C 20.3–21.2

Min temp (night)12.0 °C 9.60–14.4

Precipitation18.3 mm/mo 6.10–30.4

Air humidity56.4 % 53.6–59.1

Moisture balance-103 mm/mo -135–-69.9

Vapour deficit896 Pa 851–942

Wind speed3.40 m/s 2.30–4.40

Cloud cover34.8 % 32.0–37.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)