Aeonium arboreum

(L.) Webb & Berthel. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Aeonium

At a glance

Occurrence records3 657

Data sources12

Biological traits38

DNA specimens8

eDNA detections8

Sources12 archives

Databases and archives Aeonium arboreum's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 657 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources38 traits

Chemical compositionLOTUS · NPASS6 compounds

Occurrence & distributionGBIF3 657 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB · GoaT · NCBI≈1.3 Gbp

01Narrative

Aeonium arboreum, the tree aeonium, tree houseleek, or Irish rose, is a succulent, subtropical subshrub in the flowering plant family Crassulaceae. It is an invasive weed in places outside its natural distribution, for example as a garden escape throughout temperate southern Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Inflorescence length max15 cm

Inflorescence length min8 cm

Leaf length70 mm

Leaf length max150 mm

Leaf length min50 mm

Leaf width22.5 mm

Leaf width max45 mm

Leaf width min15 mm

Plant height0.85 m

⚠ sources differ — AusTraits: 0.85 m · TRY: 0.8 m

Plant height max2 m

Plant height min0.5 m

Seed mass0.048 mg

Life cycle & reproduction8

Flower colouryellow

Flower length max7 mm

Flower length min5 mm

Flowering endJun

Flowering startNov

Life formsucculent subshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 500 m

Elevation min0 m

Epiphyteterrestrial

Fruit typefollicle

Growth formshrub

Leaf compoundnesssimple

Leaf formoblong

Leaf shapeoblanceolate obovate

Succulenceyes

Woodinesswoody

Other traits4

Leaf arrangementrosette

Leaf thickness max3 mm

Leaf thickness min1.5 mm

Plant support typefree-standing

03Chemical composition6 compounds

Compounds documented for Aeonium arboreum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols6

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
2-(3,4-Dihydroxyphenyl)-7-hydroxy-3,5-dimethoxy-4H-1-benzopyran-4-one	present	LOTUS
Jaranol	present	NPASS
Quercetin 3',4',7-trimethyl ether	present	LOTUS
Rhamnazin	present	LOTUS
Rhamnetin	present	LOTUS
Tetramethylquercetin	present	LOTUS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeonium arboreum has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes5

GenBank sequences10

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMW879426.1 ↗599 bp

ACGT

GTCGAAGCCTAGAAAGCACGACCGCGAATGAGTTGCTAATTGCAGCGAGGGTACGCTCGCTCCCTTCGTTTGTGGGCCTAGACAAGATCT …

Aeonium arboreum voucher LivCol_1973-20551 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Aeonium arboreum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 328 746 435 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aeonium arboreum1.33 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Ploidypolyploid inferred

Chromosome records34–602n range48median60mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 602×CCDB · iber-fl · CCDB · book-atlas-flowering-plants

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

CCDB · book-atlas-flowering-plants

2n 341×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — SHARMA, A.K., & S. GHOSH. 1967. Cytotaxonomy of Crassulaceae. Biol. Zentralbl. 86 Suppl.: 313-336.

2n 361×CCDB · kew

CCDB · kew — Suda J, Kyncl T, Jarolimova V. 2005. Genome size variation in Macaronesian angiosperms: forty percent of the Canarian endemic flora completed. Plant Systematics and Evolution 252: 215-238.

n 182×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Liu, H. y. 1989. Systematics of Aeonium (Crassulaceae). Special Publ. Natl. Mus. Nat. Sci. 3.

n 361×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Liu, H. y. 1989. Systematics of Aeonium (Crassulaceae). Special Publ. Natl. Mus. Nat. Sci. 3.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type3 657 records

Wild obs. + sensor3 434

Museum / vouchered198

Cultivated / captive5

Other20

Origin

Native59

Introduced59

Range

Area of Occupancy AOO9 232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 2 072≤1 km 291≤10 km 200>10 km 26

2 589 georeferenced · 845 without coordinates

Open the mapobservation + sensor3 434

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 28≤1 km 54≤10 km 12

94 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence198

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	48
Adelaide, AU	31
BIO-UNIPIlocation not on record	21
Hobart, AU	8
Auckland, NZ	6
Canberra, AU	5
College of the Atlantic, Museumlocation not on record	5
Santa Barbara, US	5
Kensington, AU	5
València, ES	5
San Diego, US	5
Phyletisches Museum Jenalocation not on record	5
BClocation not on record	4
BDBClocation not on record	3
Riverside, US	3
Alicante, ES	3
Canadian Department of Agriculturelocation not on record	3
Jaén, ES	3
Uniwersytet Jagiellońskilocation not on record	2
Wellington, NZ	2
Moscow State Universitylocation not on record	2
Mount Annan, AU	2
Barcelona, ES	2
Badajoz, ES	2
Claremont, US	2
La Paz, BO	1
Wlocation not on record	1
CICYTEXlocation not on record	1
JBSlocation not on record	1
Museo Entomologico de Leonlocation not on record	1
Zürich, CH	1
Bronx, US	1
MAlocation not on record	1
Madison, US	1
Austin, US	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
GZUlocation not on record	1
Mexico City, MX	1

38 institutions · 195 of 198 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Aeonium arboreum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

Coastal sage scrub.|granitic |Phenology=FL

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 14.6–14.6

Seasonal swing summer↔winter7.40 °C

Max temp (day)18.0 °C

Min temp (night)11.0 °C

Precipitation49.4 mm/mo

Air humidity60.5 %

Moisture balance-42.9 mm/mo

Vapour deficit653 Pa

Wind speed1.20 m/s

Cloud cover30.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aeonium arboreum

At a glance

Sources12 archives

Size & morphology12

Life cycle & reproduction8

Diet & foraging1

Habitat & environment13

Other traits4

Compound class profile1 class

Documented compounds6 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type3 657 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions23 of 38 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 657 records