Aeolothrips kuwanaii — The Life Data

Animalia/Arthropoda/Insecta/Thysanoptera/Aeolothripidae/Aeolothrips

At a glance

Occurrence records40

Data sources7

Biological traits0

DNA specimens4

eDNA detections0

Sources7 archives

Databases and archives Aeolothrips kuwanaii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility40 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF40 records

DNA & barcodingBOLD4 specimens

01Narrative

Aeolothrips kuwanaii is a species of predatory thrip in the family Aeolothripidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeolothrips kuwanaii has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

16Tmostly conserved

82Cmostly conserved

109Gmostly conserved

163Tmostly conserved

293Gmostly conserved

325Gmostly conserved

385Cmostly conserved

541Gmostly conserved

TCTATATTTTATCTTTGGAGCGTGATCAGGGATACTTGGTCTCTCACTTAGAATACTAATTCGAATCACCCTACGAACAAACATGAAACC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.61%

Haplotypes4

BIN1

Most divergent pair0.92%

N.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type40 records

Wild obs. + sensor10

Museum / vouchered30

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 2

4 georeferenced · 6 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤1 km 24≤10 km 4

28 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	26
San Francisco, US	1
Provo, US	1
New Haven, US	1
Washington, US	1

5 institutions · 30 of 30 vouchered records shown