Aeolothrips fasciatus

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Thysanoptera/Aeolothripidae/Aeolothrips

At a glance

Occurrence records845

Data sources6

Biological traits0

DNA specimens225

eDNA detections563

Sources6 archives

Databases and archives Aeolothrips fasciatus's data was compiled from.

GBIFGlobal Biodiversity Information Facility845 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI563 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics225 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF845 records

Environmental DNA5 datasets · 10 countries563 detections

DNA & barcodingBOLD225 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding225 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeolothrips fasciatus has left across the world's sequence archives.

At a glance

DNA specimens225

BINs2

Marker genes2

eDNA detections563

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus179 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 94 variable positions, in barcode order

4Tmostly conserved

5Tmostly conserved

7Amostly conserved

9Amostly conserved

10Tmostly conserved

12Tmostly conserved

13Cmostly conserved

14Amostly conserved

16Tmostly conserved

17Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Gmostly conserved

24Cmostly conserved

25Cmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

34Gmostly conserved

35Amostly conserved

36Tmostly conserved

37Amostly conserved

38Cmostly conserved

41Gmostly conserved

42Gmostly conserved

43Tmostly conserved

44Tmostly conserved

45Tmostly conserved

46Amostly conserved

48Cmostly conserved

49Cmostly conserved

51Tmostly conserved

52Amostly conserved

53Amostly conserved

54Gmostly conserved

55Tmostly conserved

57Tmostly conserved

58Amostly conserved

61Tmostly conserved

64Cmostly conserved

65Cmostly conserved

66Gmostly conserved

67Amostly conserved

68Amostly conserved

69Tmostly conserved

70Tmostly conserved

72Amostly conserved

73Cmostly conserved

74Cmostly conserved

75Tmostly conserved

76Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Amostly conserved

81Amostly conserved

82Tmostly conserved

130Tmostly conserved

199Amostly conserved

340Tmostly conserved

364Cvariable

403Tmostly conserved

421Cmostly conserved

472Cmostly conserved

523Tmostly conserved

550Tmostly conserved

574Cmostly conserved

622Gmostly conserved

626Gmostly conserved

631Amostly conserved

632Gmostly conserved

633Amostly conserved

634Cmostly conserved

637Amostly conserved

639Tmostly conserved

640Cmostly conserved

642Tmostly conserved

643Amostly conserved

644Tmostly conserved

645Amostly conserved

646Tmostly conserved

647Cmostly conserved

648Amostly conserved

649Gmostly conserved

650Cmostly conserved

651Amostly conserved

652Cmostly conserved

654Tmostly conserved

655Amostly conserved

656Tmostly conserved

658Tmostly conserved

AATTTTATATTTCATTTTTGGGGCCTGATCTGGGATACTAGGTTTATCCTTAAGTATAATTATCCGAATTAACCTGCGAAATAATATAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.8%

Haplotypes12

BIN1

Most divergent pair5.3%

EuropeN.AmericaOther

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type845 records

Wild obs. + sensor125

Museum / vouchered697

Other23

Range

Area of Occupancy AOO1 264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 24≤1 km 93≤10 km 1

118 georeferenced · 7 without coordinates

Open the mapobservation + sensor125

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 139≤1 km 89≤10 km 36>10 km 8

272 georeferenced · 425 without coordinates

Open the institutions mapphysical evidence697

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	198
MZLUlocation not on record	101
SLU Artdatabankenlocation not on record	78
University of Guelph, Centre for Biodiversity Genomicslocation not on record	54
MWLRlocation not on record	51
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	51
Norwegian Institute of Bioeconomy Researchlocation not on record	34
New Zealand Arthropod Collectionlocation not on record	28
Stockholm, SE	17
Helsinki, FI	7
BioFokuslocation not on record	6
Tartu, EE	5
Australian National Fish Collectionlocation not on record	5
Biofokuslocation not on record	4
NTNU-VMlocation not on record	3
NTNU University Museum, Department of Natural Historylocation not on record	3
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
Kuopio, FI	1
Honolulu, US	1
Auckland, NZ	1
US	1
Champaign, US	1
DPIlocation not on record	1

23 institutions · 653 of 697 vouchered records shown · 44 without an institution code

09Environmental DNA563 detections

Where the DNA of Aeolothrips fasciatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found563

Studies independent surveys5

Countries10

Verifiable raw sequence linked313

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 563 detections have coordinates

Open the map10 countries0

1. Forest & Woodland | 1.4. Temperate Forestfarm14. Artificial - Terrestrial|14.1 Arable LandOn Quercus.4. Grassland | 4.4. Grassland - TemperateAgricultural

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 10.9–19.4

Seasonal swing summer↔winter19.2 °C

Max temp (day)19.7 °C 14.9–24.0

Min temp (night)12.2 °C 6.80–14.5

Precipitation73.5 mm/mo 50.5–96.7

Air humidity59.5 % 55.4–62.1

Moisture balance-42.8 mm/mo -73.4–-5.30

Vapour deficit689 Pa 550–910

Wind speed3.30 m/s 2.30–4.20

Cloud cover44.7 % 38.7–53.0

CHELSA 1981–2010, ~9 km grid, at location & month of 548 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)