Aeolothrips albicinctus

Haliday, 1836 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Thysanoptera/Aeolothripidae/Aeolothrips

At a glance

Occurrence records171

Data sources6

Biological traits0

DNA specimens41

eDNA detections89

Sources6 archives

Databases and archives Aeolothrips albicinctus's data was compiled from.

GBIFGlobal Biodiversity Information Facility171 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI89 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF171 records

Environmental DNA4 datasets · 5 countries89 detections

DNA & barcodingBOLD41 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeolothrips albicinctus has left across the world's sequence archives.

At a glance

DNA specimens41

BINs1

Marker genes1

eDNA detections89

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 73 variable positions, in barcode order

4Tmostly conserved

16Amostly conserved

17Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Gmostly conserved

24Cmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Gmostly conserved

30Cmostly conserved

31Amostly conserved

32Gmostly conserved

33Gmostly conserved

34Tmostly conserved

35Amostly conserved

36Tmostly conserved

37Gmostly conserved

38Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

43Tmostly conserved

44Cmostly conserved

45Tmostly conserved

46Cmostly conserved

47Tmostly conserved

48Cmostly conserved

49Tmostly conserved

51Tmostly conserved

52Amostly conserved

53Amostly conserved

54Gmostly conserved

55Tmostly conserved

57Tmostly conserved

58Amostly conserved

59Cmostly conserved

61Tmostly conserved

62Amostly conserved

64Cmostly conserved

65Cmostly conserved

66Gmostly conserved

67Tmostly conserved

68Amostly conserved

69Tmostly conserved

72Cmostly conserved

73Cmostly conserved

74Cmostly conserved

75Tmostly conserved

76Amostly conserved

78Gmostly conserved

80Amostly conserved

81Amostly conserved

82Tmostly conserved

211Tmostly conserved

214Amostly conserved

235Gmostly conserved

247Tmostly conserved

253Tmostly conserved

292Tmostly conserved

301Avariable

313Gmostly conserved

409Amostly conserved

418Cmostly conserved

433Amostly conserved

448Cmostly conserved

457Amostly conserved

460Tmostly conserved

466Cmostly conserved

580Gmostly conserved

652Cmostly conserved

TATTCTGTACCTTCTATTTGGGGCTTGGTCAGGTATGTTAGGTCTCTCTTTAAGTATACTTATCCGTATTACCCTACGAAATAATATAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes15

BIN1

Most divergent pair4.1%

EuropeN.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type171 records

Wild obs. + sensor57

Museum / vouchered106

Other8

Range

Area of Occupancy AOO480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 34≤1 km 10≤10 km 11>10 km 1

56 georeferenced · 1 without coordinates

Open the mapobservation + sensor57

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 36≤1 km 19≤10 km 3>10 km 1

59 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence106

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	28
SLU Artdatabankenlocation not on record	28
MZLUlocation not on record	17
Stockholm, SE	9
Norwegian Institute of Bioeconomy Researchlocation not on record	8
Kuopio, FI	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Tartu, EE	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
NTNU-VMlocation not on record	1

10 institutions · 100 of 106 vouchered records shown · 3 without an institution code

09Environmental DNA89 detections

Where the DNA of Aeolothrips albicinctus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found89

Studies independent surveys4

Countries5

Verifiable raw sequence linked46

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 89 detections have coordinates

Open the map5 countries0

1. Forest & Woodland|1.1. Boreal ForestdeadwoodfarmBeach meadow with sedges.On Prunus spinosaIn mixed herbaceous vegetation

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 10.1–17.1

Seasonal swing summer↔winter19.5 °C

Max temp (day)17.8 °C 13.5–21.2

Min temp (night)10.4 °C 6.40–13.8

Precipitation67.8 mm/mo 50.6–103

Air humidity59.2 % 56.7–62.0

Moisture balance-43.8 mm/mo -65.0–22.4

Vapour deficit672 Pa 493–774

Wind speed3.30 m/s 2.20–4.30

Cloud cover47.7 % 39.8–54.1

CHELSA 1981–2010, ~9 km grid, at location & month of 85 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)