Aeolesthes sarta

(Solsky, 1871) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Aeolesthes

At a glance

Occurrence records9

Data sources7

Biological traits0

DNA specimens8

eDNA detections8

Sources7 archives

Databases and archives Aeolesthes sarta's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF9 records

Environmental DNA1 datasets · 0 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Aeolesthes sarta, commonly known as the city longhorn beetle, is a species of beetle in the family Cerambycidae, the longhorn beetles.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeolesthes sarta has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

73Gmostly conserved

124Tmostly conserved

154Tmostly conserved

175Amostly conserved

178Cmostly conserved

187Cmostly conserved

211Amostly conserved

268Cmostly conserved

271Cmostly conserved

295Avariable

328Amostly conserved

373Avariable

376Amostly conserved

391Amostly conserved

406Cmostly conserved

415Amostly conserved

436Tmostly conserved

442Tmostly conserved

451Tmostly conserved

490Tmostly conserved

502Tmostly conserved

526Amostly conserved

565Gvariable

571Cmostly conserved

577Gmostly conserved

580Tmostly conserved

598Tmostly conserved

AACACTTTACTTTATTTTTGGAGCTAGTGAAGGAATAGTGGGTTCTTCATTAAGAATACTAATCCGAACCGAGCTAGGGATACCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes7

BIN1

Most divergent pair1.8%

Other

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type9 records

Museum / vouchered9

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence9

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	8
Adam Mickiewicz University in Poznańlocation not on record	1

2 institutions · 9 of 9 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Aeolesthes sarta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)