Aenetus splendens

(Scott, 1864) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hepialidae/Aenetus

At a glance

Occurrence records85

Data sources6

Biological traits0

DNA specimens5

eDNA detections5

Sources6 archives

Databases and archives Aenetus splendens's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility85 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF85 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Aenetus splendens is a moth of the family Hepialidae. It is known from New South Wales and Queensland.Australian Faunal Directory The wingspan is about 70 mm for females and 50 mm for males. Adult males have green forewings with white diagonal bars. The hindwings are shiny pale grey. Females have green forewings with variable red markings and red hindwings. The larvae bore in the stems of saplings of various plants, including Syzygium smithii, Callistemon, Eucalyptus, Callicoma serratifolia, Trema aspera, Casuarina, Dodonaea, Lantana camara, Pandorea pandorana and Rubus. They create a web made of silk and sawdust which covers the entrance to the tunnel. Pupation takes place inside the tunnel.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aenetus splendens has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P307 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.13%

Haplotypes2

BIN1

Most divergent pair0.33%

Where individuals differ — all 1 variable positions, in barcode order

154Tmostly conserved

AACTTTATACTTTATTTTTGGAATTTGATCAGGTATAGTTGGAACATCTTTAAGATTATTAATTCGAACAGAATTAGGAAACCCAGGATC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type85 records

Wild obs. + sensor68

Museum / vouchered17

Range

Area of Occupancy AOO264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 29≤1 km 15≤10 km 6>10 km 7

57 georeferenced · 11 without coordinates

Open the mapobservation + sensor68

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤1 km 6≤10 km 4

10 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tasmanian Museum & Art Gallerylocation not on record	6
Sydney, AU	5
Australian National Insect Collectionlocation not on record	3

3 institutions · 14 of 17 vouchered records shown · 3 without an institution code

09Environmental DNA5 detections

Where the DNA of Aenetus splendens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.9 °C 20.8–23.0

Seasonal swing summer↔winter11.6 °C

Max temp (day)25.2 °C 24.1–28.1

Min temp (night)17.4 °C 16.7–18.4

Precipitation122 mm/mo 84.6–144

Air humidity61.4 % 57.4–62.8

Moisture balance8.20 mm/mo -76.2–25.0

Vapour deficit951 Pa 913–1,201

Wind speed2.40 m/s 2.20–3.40

Cloud cover26.6 % 22.2–29.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)