Aenasius arizonensis

(Girault, 1915) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Encyrtidae/Aenasius

At a glance

Occurrence records21

Data sources8

Biological traits0

DNA specimens205

eDNA detections50

Sources8 archives

Databases and archives Aenasius arizonensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics205 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF21 records

Environmental DNA1 datasets · 3 countries50 detections

DNA & barcodingBOLD205 specimens

Genome at a glanceGoaT · NCBI≈399 Mbp

01Narrative

Aenasius arizonensis is een vliesvleugelig insect uit de familie Encyrtidae. De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1915 door Girault.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding205 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aenasius arizonensis has left across the world's sequence archives.

At a glance

DNA specimens205

BINs12

Marker genes2

eDNA detections50

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P618 bp consensus137 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Diversity (π)5.0%

Haplotypes2

BINs11

Most divergent pair1.6%

Where individuals differ — all 96 variable positions, in barcode order

49Amostly conserved

66Gmostly conserved

78Amostly conserved

79Gmostly conserved

81Amostly conserved

87Amostly conserved

89Cmostly conserved

96Amostly conserved

102Amostly conserved

120Tmostly conserved

129Gmostly conserved

135Gmostly conserved

138Gmostly conserved

156Gmostly conserved

157Gmostly conserved

162Gmostly conserved

166Amostly conserved

168Gmostly conserved

169Tmostly conserved

174Gmostly conserved

175Gmostly conserved

176Cmostly conserved

177Cmostly conserved

180Tmostly conserved

189Gmostly conserved

195Gmostly conserved

201Gmostly conserved

210Amostly conserved

213Amostly conserved

228Tmostly conserved

231Amostly conserved

234Gmostly conserved

243Tmostly conserved

251Tmostly conserved

255Tmostly conserved

262Amostly conserved

267Tmostly conserved

270Gmostly conserved

273Gmostly conserved

276Tmostly conserved

285Gmostly conserved

288Amostly conserved

291Amostly conserved

297Cmostly conserved

303Amostly conserved

330Cmostly conserved

336Tmostly conserved

369Gmostly conserved

372Gmostly conserved

373Gmostly conserved

374Cmostly conserved

375Tmostly conserved

378Tmostly conserved

387Gmostly conserved

393Tmostly conserved

406Amostly conserved

408Gmostly conserved

432Gmostly conserved

438Gmostly conserved

444Amostly conserved

448Tmostly conserved

450Amostly conserved

453Gmostly conserved

457Gmostly conserved

458Tmostly conserved

459Amostly conserved

463Tmostly conserved

465Tmostly conserved

466Gmostly conserved

468Tmostly conserved

471Tmostly conserved

477Amostly conserved

492Gmostly conserved

495Gmostly conserved

498Amostly conserved

501Gmostly conserved

507Amostly conserved

510Amostly conserved

513Amostly conserved

516Gmostly conserved

518Gmostly conserved

519Tmostly conserved

534Gmostly conserved

543Tmostly conserved

549Gmostly conserved

558Amostly conserved

567Cvariable

570Tmostly conserved

571Amostly conserved

572Cmostly conserved

573Amostly conserved

579Gmostly conserved

582Gmostly conserved

588Tmostly conserved

591Amostly conserved

594Gmostly conserved

TTATCTTTAAGTATGATTATTCGAATGGAGTTAAGAACTCCTGGGTCTATAATTGGTAATGATCAGATTTATAATTCAGTAGTTACAGCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Blepyrus insularissame family12.5%Brasema leucothysanasame order14.3%Metaphycus lounsburyisame family14.8%Cryptanusia aureiscutellumsame family15.2%Sphaeripalpus fuscipessame order15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_045852 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2ND3COX3ATP6ATP8COX2COX1ND5ND4ND4LND6CYTBND1rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aenasius arizonensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈398 693 586 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aenasius arizonensis0.40 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type21 records

Wild obs. + sensor1

Museum / vouchered20

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 20 records without

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Centre for Biodiversity Genomicslocation not on record	11
University of Central Floridalocation not on record	3
National Institute for Biotechnology and Genetic Engineeringlocation not on record	2

3 institutions · 16 of 20 vouchered records shown · 1 without an institution code

09Environmental DNA50 detections

Where the DNA of Aenasius arizonensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map3 countries0

SuburbanOpen forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median29.6 °C 21.9–33.0

Seasonal swing summer↔winter20.4 °C

Max temp (day)32.8 °C 27.4–38.8

Min temp (night)24.5 °C 14.5–26.6

Precipitation210 mm/mo 17.6–329

Air humidity60.0 % 45.8–60.0

Moisture balance27.1 mm/mo -155–147

Vapour deficit1,666 Pa 1,453–2,735

Wind speed1.40 m/s 1.30–2.70

Cloud cover22.8 % 18.4–25.1

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)