Aeluropus lagopoides

(L.) Thwaites · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Aeluropus

At a glance

Occurrence records502

Data sources11

Biological traits19

DNA specimens18

eDNA detections10

Sources11 archives

Databases and archives Aeluropus lagopoides's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility502 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF502 records

Environmental DNA1 datasets · 4 countries10 detections

DNA & barcodingBOLD · NCBI18 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Aeluropus lagopoides, sometimes called mangrove grass or rabbit-foot aeluropus, is a species of Eurasian and African plant in the grass family, found primarily in salty soils and waste places.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.3 m

Plant height min0.07 m

Life cycle & reproduction5

Flowering endAug

Flowering startMar

Life formperennial or subshrub

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 030 m

Elevation min600 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTsaline places, sand

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

03Chemical composition5 compounds

Compounds documented for Aeluropus lagopoides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavones5

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
Isoorientin 7-O-(6'''-O-(E)-feruloyl)glucoside	present	LOTUS
Isovitexin	present	LOTUS
Orientin	present	LOTUS
Vicenin-2	present	LOTUS
Vitexin 6''-O-malonyl 2''-O-xyloside	present	LOTUS

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeluropus lagopoides has left across the world's sequence archives.

At a glance

DNA specimens18

Marker genes4

GenBank sequences10

eDNA detections10

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPX022141.1 ↗333 bpUnited Arab Emirates · 2022

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAGACCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCCAA …

Aeluropus lagopoides voucher FEUQ79 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aeluropus lagopoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidypolyploid inferred

Chromosome records20–502n range28median20mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 204×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +1

CCDB · ipcn-api-dl — Nagabhushana Rao Sindhe, A. 1980. In Chromosome number reports LXVIII. Taxon 29: 545.

CCDB · book-ipcn67-71 — MURIN, A., & I.I. CHAUDHRI. 1970. In IOPB chromosome number reports XXVI. Taxon 19: 264-269. 70-322 NAG, K.K., & B.M. JOHRI. 1969. Organogenesis and chromosomal constitution in embryo callus of Nuytsia floribunda. Phytomorphology 19: 405-408.

CCDB · book-ipcn73-74 — GOULD, F.W., & T.R. SODERSTROM. 1974. Chromosome numbers of some Ceylon grasses. Canad. J. Bot. 52: 1075-1090.

CCDB · book-indian_vol2 — Murin, A. & Chaudhri, I.I. 1970 ; Gould, F.W. & Soderstrom, T.R. 1974

2n 503×CCDB · book-ipcn67-71 · CCDB · book-indian_vol2

CCDB · book-ipcn67-71 — BAQUAR, s.R., & M. SAEED. 1969. Chromosome studies and polyploidy analysis in grasses of West Pakistan. I. Caryologia 22: 103-111.

CCDB · book-ipcn67-71 — BAQUAR, S.R . & M. SAEED. 1969. Chromosome ~tudies and polyploidy analysis in grasses of West Pakistan I. Caryologia 22: 103-111.

CCDB · book-indian_vol2 — Baquar, S.R. & Saeed, M. 1969

2n 361×CCDB · book-indian_vol2

CCDB · book-indian_vol2 — Krishnaswamy, N. 1941

n 202×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Moinuddin, M., A. A. Vahidy & S. I. Ali. 1994. Chromosome counts in Arundinoideae, Chloridoideae, and Poideae (Poaceae) from Pakistan. Ann. Missouri Bot. Gard. 81(4): 784–791.

CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type502 records

Wild obs. + sensor292

Museum / vouchered209

Other1

Range

Area of Occupancy AOO1 244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 72≤1 km 8≤10 km 12>10 km 2

94 georeferenced · 198 without coordinates

Open the mapobservation + sensor292

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 5≤1 km 44≤10 km 40

89 georeferenced · 120 without coordinates

Open the institutions mapphysical evidence209

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Baroda, IN	40
QAUlocation not on record	27
Kew, GB	19
LDlocation not on record	14
Wlocation not on record	13
Edinburgh, GB	12
Pondicherry, IN	10
PRClocation not on record	9
Dehra Dun, IN	6
Uniwersytet Śląski w Katowicachlocation not on record	5
Moscow State Universitylocation not on record	5
Stockholm, SE	4
Dresden, DE	4
Uppsala, SE	3
University of Stellenboschlocation not on record	2
Sharjah Research Academy, Seed Bank and Herbariumlocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Sharjah Seed Bank & Herbariumlocation not on record	2
Universität Tübingenlocation not on record	2
Gujarat Biodiversity Gene Banklocation not on record	2
Natural History Museum Rotterdamlocation not on record	1
Sevilla, ES	1
Saint Louis, US	1
Berlin, DE	1
Universität Göttingenlocation not on record	1
València, ES	1
BRNUlocation not on record	1
Salamanca, ES	1
GJOlocation not on record	1
University of Hargeisalocation not on record	1
BClocation not on record	1
South Kensington, GB	1
Bloomington, US	1
Rishon Le Zion, IL	1
Bronx, US	1

35 institutions · 198 of 209 vouchered records shown · 10 without an institution code

09Environmental DNA10 detections

Where the DNA of Aeluropus lagopoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 21.4–34.0

Seasonal swing summer↔winter15.3 °C

Max temp (day)30.1 °C 25.3–39.4

Min temp (night)20.2 °C 17.1–28.6

Precipitation2.70 mm/mo 0.6–26.2

Air humidity50.7 % 41.4–56.8

Moisture balance-128 mm/mo

Vapour deficit1,721 Pa 1,142–2,810

Wind speed3.60 m/s

Cloud cover14.9 % 2.30–22.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)