Aelia rostrata

Boheman, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Aelia

At a glance

Occurrence records1 523

Data sources6

Biological traits0

DNA specimens17

eDNA detections16

Sources6 archives

Databases and archives Aelia rostrata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 523 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 523 records

Environmental DNA1 datasets · 2 countries16 detections

DNA & barcodingBOLD17 specimens

01Narrative

L'Aelia rostrata Boheman, 1852, è un insetto appartenente all'ordine dei Rincoti e al sottordine Heteroptera.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aelia rostrata has left across the world's sequence archives.

At a glance

DNA specimens17

BINs3

Marker genes2

eDNA detections16

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 51 variable positions, in barcode order

57Cvariable

96Gmostly conserved

102Cvariable

114Tmostly conserved

132Cvariable

141Tmostly conserved

168Tmostly conserved

186Cvariable

207Amostly conserved

210Tmostly conserved

219Tvariable

243Cvariable

246Cvariable

262Cvariable

280Tmostly conserved

283Tmostly conserved

318Amostly conserved

333Amostly conserved

339Avariable

342Cvariable

348Cvariable

375Tvariable

381Tmostly conserved

382Cmostly conserved

390Tmostly conserved

403Tmostly conserved

414Tmostly conserved

426Gvariable

429Amostly conserved

438Tmostly conserved

441Cvariable

453Tmostly conserved

459Tvariable

470Cmostly conserved

483Cvariable

489Amostly conserved

492Tmostly conserved

495Amostly conserved

516Amostly conserved

529Cvariable

546Amostly conserved

549Cvariable

570Cvariable

576Amostly conserved

579Gvariable

591Tmostly conserved

609Tmostly conserved

624Avariable

630Tmostly conserved

637Tmostly conserved

642Cmostly conserved

CTATATTTCATATTTGGTATATGAGCAGGTATAGTAGGATCCGCCATAAGATTAATCATTCGTATTGAATTAGGTCAACCCGGAAGATTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes8

BINs3

Most divergent pair5.0%

OtherEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aelia germarisame genus1.5%Derula flavoguttatasame family12.0%Mormidea collarissame family12.2%Stagonomus bipunctatussame family12.3%Aplerotus maculatussame family12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 523 records

Wild obs. + sensor1 431

Museum / vouchered59

Other33

Range

Area of Occupancy AOO4 380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 494≤1 km 202≤10 km 330>10 km 45

1 071 georeferenced · 360 without coordinates

Open the mapobservation + sensor1 431

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 5≤1 km 11≤10 km 15>10 km 4

35 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence59

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	5
CIBIOlocation not on record	3
European Distributed Institute of Taxonomy (EDIT)location not on record	2
Museu Nacional de História Natural e da Ciêncialocation not on record	1
Cornell University Insect Collectionlocation not on record	1

5 institutions · 12 of 59 vouchered records shown · 47 without an institution code

09Environmental DNA16 detections

Where the DNA of Aelia rostrata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map2 countries0

3231Urban pine forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.7 °C 11.3–23.0

Seasonal swing summer↔winter16.7 °C

Max temp (day)23.8 °C 15.1–29.6

Min temp (night)12.4 °C 7.30–16.3

Precipitation48.8 mm/mo 15.3–76.5

Air humidity54.6 % 50.9–62.5

Moisture balance-104 mm/mo -149–-8.00

Vapour deficit981 Pa 552–1,393

Wind speed2.90 m/s 2.10–4.60

Cloud cover39.2 % 35.0–42.9

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aelia rostrata

At a glance

Sources6 archives

At a glance

Record type1 523 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 523 records