Aelia klugii

Hahn, 1833 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Aelia

At a glance

Occurrence records1 220

Data sources7

Biological traits0

DNA specimens9

eDNA detections7

Sources7 archives

Databases and archives Aelia klugii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 220 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 220 records

Environmental DNA2 datasets · 3 countries7 detections

DNA & barcodingBOLD9 specimens

01Narrative

Aelia klugii Der Gestreifte Spitzling (Aelia klugii) ist eine Wanzenart aus der Familie der Baumwanzen (Pentatomidae). Sie ist neben Aelia acuminata und Aelia rostrata eine der drei Arten der Gattung Aelia, die in Mitteleuropa vorkommt.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aelia klugii has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections7

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

7Amostly conserved

10Cmostly conserved

13Tmostly conserved

14Amostly conserved

61Tmostly conserved

64Tmostly conserved

67Tmostly conserved

79Amostly conserved

88Amostly conserved

97Tmostly conserved

136Cmostly conserved

166Amostly conserved

187Cmostly conserved

190Amostly conserved

250Tmostly conserved

271Amostly conserved

292Amostly conserved

328Tmostly conserved

340Cmostly conserved

373Amostly conserved

386Tmostly conserved

412Tmostly conserved

472Tmostly conserved

473Gmostly conserved

496Tmostly conserved

500Cmostly conserved

505Cmostly conserved

523Tmostly conserved

530Tmostly conserved

533Tmostly conserved

542Cmostly conserved

557Cmostly conserved

578Tmostly conserved

604Tmostly conserved

628Amostly conserved

640Tmostly conserved

646Cmostly conserved

652Cmostly conserved

AACCCTATACTTTATATTTGGAATATGAGCAGGAATAGTAGGATCAGCTATAAGATTAATTATTCGTATTGAATTAGGACAACCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes3

BINs2

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aelia sibiricasame genus3.5%Aelia virgatasame genus11.1%Graphosoma rubrolineatumsame family12.0%Neottiglossa lineolatasame family12.0%Graphosoma melanoxanthumsame family12.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 220 records

Wild obs. + sensor943

Museum / vouchered268

Other9

Range

Area of Occupancy AOO3 196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 324≤1 km 225≤10 km 325>10 km 6

880 georeferenced · 63 without coordinates

Open the mapobservation + sensor943

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 52≤1 km 47≤10 km 129

228 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence268

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	22
Tartu, EE	17
Provincia di Livornolocation not on record	12
Philadelphia, US	11
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	9
Bonn, DE	6
WGSlocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	2
Metsähallituslocation not on record	2
Kuopio, FI	1
Tallinn, EE	1
Forssa, FI	1
Jyväskylä, FI	1

13 institutions · 87 of 268 vouchered records shown · 181 without an institution code

09Environmental DNA7 detections

Where the DNA of Aelia klugii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys2

Countries3

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 11.0–17.0

Seasonal swing summer↔winter24.5 °C

Max temp (day)18.5 °C 13.9–21.0

Min temp (night)11.8 °C 7.00–12.7

Precipitation69.1 mm/mo 54.1–109

Air humidity58.3 % 56.7–61.0

Moisture balance-41.4 mm/mo -42.7–-7.90

Vapour deficit705 Pa 576–771

Wind speed2.60 m/s 2.20–3.50

Cloud cover46.7 % 39.7–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aelia klugii

At a glance

Sources7 archives

At a glance

Record type1 220 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 220 records