Aelia americana

Dallas, 1851 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Aelia

At a glance

Occurrence records214

Data sources6

Biological traits0

DNA specimens17

eDNA detections16

Sources6 archives

Databases and archives Aelia americana's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility214 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF214 records

Environmental DNA1 datasets · 2 countries16 detections

DNA & barcodingBOLD17 specimens

01Narrative

Aelia americana is a species of stink bug in the family Pentatomidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aelia americana has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections16

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

37Amostly conserved

47Gmostly conserved

49Cmostly conserved

82Amostly conserved

90Gmostly conserved

190Tmostly conserved

253Amostly conserved

282Cmostly conserved

343Tmostly conserved

410Gmostly conserved

415Gmostly conserved

478Cvariable

487Tmostly conserved

520Amostly conserved

542Tmostly conserved

601Tmostly conserved

616Cmostly conserved

625Gvariable

649Amostly conserved

CACCTTATATTTCTTATTCGGAATGTGAGCTGGTATAGTAGGATCAGCCATAAGATTAATTATTCGAATCGAATTAGGACAACCCGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.63%

Haplotypes8

BIN1

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aelia virgatasame genus10.4%Eurydema fieberisame family10.6%Eurydema rotundicollissame family11.6%Eurydema ornatasame family11.6%Aelia sibiricasame genus11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type214 records

Wild obs. + sensor139

Museum / vouchered75

Range

Area of Occupancy AOO652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 80≤1 km 18≤10 km 9>10 km 8

115 georeferenced · 24 without coordinates

Open the mapobservation + sensor139

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 5≤1 km 21≤10 km 8>10 km 6

40 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence75

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	19
Provo, US	16
Royal Saskatchewan Museumlocation not on record	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
College Station, US	4
US	2
Lubbock, US	1
Mississippi State, US	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Colorado State Universitylocation not on record	1
Champaign, US	1

11 institutions · 60 of 75 vouchered records shown · 15 without an institution code

09Environmental DNA16 detections

Where the DNA of Aelia americana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map2 countries0

site #11relic steppeRiparian ZoneGrasslandMixed Habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 13.6–19.8

Seasonal swing summer↔winter29.8 °C

Max temp (day)24.9 °C 19.1–27.0

Min temp (night)10.8 °C 8.20–14.2

Precipitation49.6 mm/mo 46.2–88.1

Air humidity52.1 % 51.0–57.3

Moisture balance-96.7 mm/mo -124–-39.9

Vapour deficit953 Pa 698–1,114

Wind speed3.90 m/s 2.50–4.20

Cloud cover36.2 % 33.4–67.3

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)