Aelia acuminata

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Aelia

At a glance

Occurrence records41 970

Data sources9

Biological traits2

DNA specimens69

eDNA detections165

Sources9 archives

Databases and archives Aelia acuminata's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 970 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI165 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics69 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF41 970 records

Environmental DNA5 datasets · 15 countries165 detections

DNA & barcodingBOLD69 specimens

Genome at a glanceGoaT · NCBI≈1.2 Gbp

01Narrative

Aelia acuminata, common name Bishop's Mitre, is a species of shield bug belonging to the family Pentatomidae.Biolib

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding69 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aelia acuminata has left across the world's sequence archives.

At a glance

DNA specimens69

BINs2

Marker genes2

eDNA detections165

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus58 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

61Tmostly conserved

79Gmostly conserved

343Amostly conserved

361Gmostly conserved

508Gmostly conserved

544Gmostly conserved

578Cmostly conserved

616Cmostly conserved

AACCTTATACTTTATCTTCGGTATATGGGCTGGAATAGTTGGATCAGCCATAAGATTAATTATTCGAATTGAATTAGGGCAACCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.83%

Haplotypes10

BINs2

Most divergent pair1.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neottiglossa undatasame family12.5%Neottiglossa leporinasame family12.5%Menida disjectasame family12.5%Chlorochroa rossianasame family12.9%Taurocerus edessoidessame family12.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aelia acuminata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 169 983 176 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aelia acuminata1.17 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.3% BUSCO

08Occurrence & distribution

Record type41 970 records

Wild obs. + sensor39 547

Museum / vouchered2 231

Cultivated / captive50

Other142

Origin

Native2

Range

Area of Occupancy AOO75 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 16 156≤1 km 6 512≤10 km 11 408>10 km 371

34 447 georeferenced · 5 100 without coordinates

Open the mapobservation + sensor39 547

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 379≤1 km 622≤10 km 848>10 km 12

1 861 georeferenced · 370 without coordinates

Open the institutions mapphysical evidence2 231

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 50 records without

Open the mapnot free-living50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	312
Tartu, EE	312
Adam Mickiewicz University in Poznańlocation not on record	112
SLU Artdatabankenlocation not on record	99
Philadelphia, US	97
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	81
Bonn, DE	36
Metsähallituslocation not on record	32
ZMAAlocation not on record	32
Helsinki, FI	31
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	27
Jyväskylä, FI	20
South Kensington, GB	18
UO-CeStuBiolocation not on record	18
European Distributed Institute of Taxonomy (EDIT)location not on record	13
Tallinn, EE	11
Provincia di Livornolocation not on record	11
Ugentlocation not on record	8
neflocation not on record	8
BioFokuslocation not on record	7
WGSlocation not on record	7
Winterthur, CH	6
ZSMlocation not on record	6
CBDClocation not on record	4
Tromsø, NO	4
Forssa, FI	4
Natural History Museum Rotterdamlocation not on record	3
NCMGlocation not on record	3
DFlocation not on record	2
Uniwersytet Łódzkilocation not on record	2
Rovaniemi, FI	2
Nanjing, CN	2
Museu Nacional de História Natural e da Ciêncialocation not on record	1
CIBIOlocation not on record	1
Kuopio, FI	1
Senckenberg Natural History Collections Dresden, Museum of Zoologylocation not on record	1
NEFlocation not on record	1
New Haven, US	1
Barcelona, ES	1
Natural History Museum, Londonlocation not on record	1

40 institutions · 1 338 of 2 231 vouchered records shown · 893 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA165 detections

Where the DNA of Aelia acuminata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found165

Studies independent surveys5

Countries15

Verifiable raw sequence linked74

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 165 detections have coordinates

Open the map15 countries0

Urban areaMediterranean forestHetraies corses (G1.673)Deciduous forestsPelouses en bord de route43

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 10.9–21.1

Seasonal swing summer↔winter18.3 °C

Max temp (day)19.4 °C 14.4–25.8

Min temp (night)12.7 °C 7.30–15.2

Precipitation58.7 mm/mo 40.1–76.7

Air humidity60.1 % 53.9–62.9

Moisture balance-52.2 mm/mo -122–-6.60

Vapour deficit726 Pa 529–1,155

Wind speed3.20 m/s 2.50–5.50

Cloud cover42.1 % 35.4–51.1

CHELSA 1981–2010, ~9 km grid, at location & month of 162 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aelia acuminata

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type41 970 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 40 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type41 970 records