Aeletes atomarius

(Aubé, 1842) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Histeridae/Aeletes

At a glance

Occurrence records820

Data sources5

Biological traits2

DNA specimens13

eDNA detections17

Sources5 archives

Databases and archives Aeletes atomarius's data was compiled from.

GBIFGlobal Biodiversity Information Facility820 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF820 records

Environmental DNA2 datasets · 4 countries17 detections

DNA & barcodingBOLD13 specimens

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeletes atomarius has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections17

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACTTTATATTTCATTTTTGGAGCTTGAGCAGGAATAGTTGGAACTTCTTTAAGCCTTTTAATTCGAGCAGAACTGGGAAATCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Platynus angustatussame order13.4%Linnaemya longirostrissame order15.2%Spilogona pacificasame order15.5%Allobaccha apicalissame order15.5%Rachispoda fuscipennissame order15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type820 records

Wild obs. + sensor552

Museum / vouchered117

Cultivated / captive4

Fossil1

Other146

Origin

Native11

Range

Area of Occupancy AOO996 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 181≤1 km 68≤10 km 178>10 km 2

429 georeferenced · 123 without coordinates

Open the mapobservation + sensor552

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 19≤1 km 33≤10 km 38>10 km 1

91 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence117

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	39
Copenhagen, DK	12
ZSMlocation not on record	11
MZLUlocation not on record	10
Bavarian State Collection of Zoologylocation not on record	7
Naturama Aargaulocation not on record	2
Muzeum Górnośląskie w Bytomiulocation not on record	2
Stockholm, SE	1
SGAV-and-NHMDlocation not on record	1
Bonn, DE	1

10 institutions · 86 of 117 vouchered records shown · 31 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA17 detections

Where the DNA of Aeletes atomarius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys2

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 13.0–17.7

Seasonal swing summer↔winter17.3 °C

Max temp (day)20.2 °C 15.9–21.8

Min temp (night)12.0 °C 9.50–13.1

Precipitation76.5 mm/mo 63.9–81.0

Air humidity60.2 % 58.0–61.0

Moisture balance-40.1 mm/mo -61.1–0.5

Vapour deficit707 Pa 582–822

Wind speed3.50 m/s 3.20–4.40

Cloud cover40.7 % 37.2–43.5

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)