Aegosoma scabricorne

(Scopoli, 1763) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Aegosoma

At a glance

Occurrence records5 340

Data sources8

Biological traits0

DNA specimens13

eDNA detections13

Sources8 archives

Databases and archives Aegosoma scabricorne's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 340 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 340 records

Environmental DNA1 datasets · 4 countries13 detections

DNA & barcodingBOLD13 specimens

Genome at a glanceGoaT2n = 20

01Narrative

Aegosoma scabricorne is a species of long-horned beetles belonging to the family Cerambycidae.Biolib Aegosoma scabricorne, male and female. Museum specimen

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aegosoma scabricorne has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections13

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

166Gmostly conserved

172Cvariable

190Tvariable

202Cvariable

250Tvariable

347Tmostly conserved

469Amostly conserved

478Amostly conserved

492Gmostly conserved

550Tmostly conserved

553Gmostly conserved

565Amostly conserved

568Tmostly conserved

578Tmostly conserved

625Amostly conserved

646Cmostly conserved

658Tmostly conserved

AACATTATATTTAATCTTTGGAGCATGATCAGGAATAGTGGGAACCTCAATAAGAGTTTTAATTCGATCTGAACTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes4

BIN1

Most divergent pair2.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aegosoma sinicumsame genus12.5%Stricticollis longicollissame order15.7%Sitona maculariussame order15.8%Menyllus maculicornussame family16.6%Anthicus nigritussame order17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Aegosoma scabricorne carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 202×GoaT · Animal Chromosome Counts Database · GoaT · Coleoptera Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type5 340 records

Wild obs. + sensor4 701

Museum / vouchered566

Other73

Origin

Native500

Range

Area of Occupancy AOO10 768 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy47% within 1 km

≤100 m 1 259≤1 km 454≤10 km 1 842>10 km 118

3 673 georeferenced · 1 028 without coordinates

Open the mapobservation + sensor4 701

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 6≤1 km 44≤10 km 466>10 km 24

540 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence566

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	68
Geneva, CH	56
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	56
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	54
Paro, BT	46
Bern, CH	20
Muzeum Górnośląskie w Bytomiulocation not on record	9
Nijmegen, NL	8
Zürich, CH	7
NTNU-VMlocation not on record	6
Musee d'Histoire Naturallelocation not on record	4
Dhaka, BD	4
Sion, CH	3
Radicondoli, IT	2
SFRAlocation not on record	2
Archäologie und Museum Baselland - Museum.BLlocation not on record	2
Paris, FR	2
Winterthur, CH	2
Musée de l'Hospice du Grand-Saint-Bernardlocation not on record	2
Frauenfeld, CH	2
	2
National Museum of Natural History, Bulgarian Academy of Scienceslocation not on record	1
INCONNUlocation not on record	1
Ciudad de México, MX	1

24 institutions · 360 of 566 vouchered records shown · 206 without an institution code

09Environmental DNA13 detections

Where the DNA of Aegosoma scabricorne was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 20.4–22.8

Seasonal swing summer↔winter18.5 °C

Max temp (day)25.2 °C 24.5–26.8

Min temp (night)15.5 °C 15.3–18.1

Precipitation45.0 mm/mo 34.6–75.0

Air humidity58.2 % 57.1–60.9

Moisture balance-113 mm/mo -125–-67.9

Vapour deficit1,075 Pa 1,020–1,084

Wind speed2.20 m/s 1.60–4.00

Cloud cover34.6 % 25.7–37.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aegosoma scabricorne

At a glance

Sources8 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 340 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 340 records