Aegopodium podagraria

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Aegopodium

At a glance

Occurrence records616 099

Data sources15

Biological traits50

DNA specimens50

eDNA detections21 167

Sources15 archives

Databases and archives Aegopodium podagraria's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility616 099 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 167 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics50 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources50 traits

Chemical compositionLOTUS · NPASS17 compounds

Occurrence & distributionGBIF616 099 records

Environmental DNA3 datasets · 12 countries21 167 detections

DNA & barcodingBOLD · NCBI50 specimens

Genome at a glanceCCDB · GoaT3.5 Gbp

01Narrative

Aegopodium podagraria, commonly called ground elder, is a species of flowering plant in the carrot family Apiaceae that grows in shady places. The name "ground elder" comes from the superficial similarity of its leaves and flowers to those of elder (Sambucus), which is not closely related. Other common names include herb gerard, bishop's weed, goutweed, gout wort, snow-in-the-mountain, English masterwort and wild masterwort. It is the type species of the genus Aegopodium. It is native to Europe and Asia, but has been introduced around the world as an ornamental plant, where it occasionally poses an ecological threat as an invasive exotic plant.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTAusTraitsLEDATRYWCVP

Size & morphology15

Fruit length3.75 mm

⚠ sources differ — AusTraits: 3.75 mm · GIFT: 4 mm

Leaf length40 mm

Leaf length max55 mm

Leaf mass754 mg

Leaf size11 367 mm²

⚠ sources differ — TRY: 11 367 mm² · LEDA: 12 318 mm² · GIFT: 13 500 mm²

Leaf width30 mm

Petiole length19 cm

Plant height0.479 m

⚠ sources differ — GIFT: 0.479 m · AusTraits: 1 m · LEDA: 0.575 m · TRY: 0.4 m

Plant height generative0.732 m

Plant height max1 m

Plant height min0.5 m

Seed length3.9 mm

Seed mass2.26 mg

⚠ sources differ — TRY: 2.26 mg · LEDA: 1.54 mg · GIFT: 1.88 mg

Seed mass max2.73 mg

Seed mass min1.53 mg

Life cycle & reproduction12

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dispersal typehuman

⚠ sources differ — LEDA: agochor · GIFT: autochorous

Flowering endJul

Flowering startJun

Life formperennial or rhizomatous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

⚠ sources differ — LEDA: Geophyte · GIFT: hemicryptophyte

Reproduction asexualabsent

Seed number335

Self fertilizationabsent

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit typemericarp

Growth formherb

Habitat GIFTcut-over forest, forest, roadsides, shrubberies

Leaf compoundnesscompound

Leaf shapelanceolate ovate

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry9

Leaf C:N ratio14.67 g/g

Leaf c422 mg/g

Leaf dry-matter content (LDMC)215 mg/g

⚠ sources differ — TRY: 215 mg/g · LEDA: 246 mg/g

Leaf n31.31 mg/g

Leaf p2.8 mg/g

Photosynthetic pathwayC3

Seed longevity index0

Specific leaf area (SLA)28.91 mm²/mg

Wood density106 mg/cm³

Other traits1

Diaspore typemericarp

03Chemical composition17 compounds

Compounds documented for Aegopodium podagraria across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Fatty alcohols7

Guaiane sesquiterpenoids3

Stigmastane steroids2

Fatty aldehydes2

Oxygenated hydrocarbons2

Documented compounds17 total

Compound	Amount	Source
(3S,3aS,5R,8R,9aR,9bR)-5,8-dihydroxy-3,6-dimethyl-9-methylidene-3,3a,4,5,7,8,9a,9b-octahydroazuleno[4,5-b]furan-2-one	present	NPASS
(3S,3aS,6aR,8R,9aR,9bS)-8-hydroxy-3-methyl-6,9-dimethylidene-3a,4,5,6a,7,8,9a,9b-octahydro-3H-azuleno[4,5-b]furan-2-one	present	NPASS
(3S,8E,10R)-heptadeca-1,8-dien-4,6-diyne-3,10-diol	present	LOTUS
(3S,8Z,10R)-heptadeca-1,8-dien-4,6-diyne-3,10-diol	present	LOTUS
(3S,9Z)-3-hydroxyheptadeca-1,9-dien-4,6-diyn-8-one	present	LOTUS
(8S,9Z)-8-hydroxyheptadeca-1,9-dien-4,6-diyn-3-one	present	LOTUS
(S)-Falcarinol	present	LOTUS
1,9-Heptadecadiene-4,6-diyn-3-one, (Z)-	present	LOTUS
1,9-Heptadecadiene-4,6-diyne-3,8-diol	present	LOTUS
7alpha-Hydroxystigmasterol	present	NPASS

05DNA & barcoding50 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aegopodium podagraria has left across the world's sequence archives.

At a glance

DNA specimens50

Marker genes6

GenBank sequences9

eDNA detections21 167

Countries12

The DNA barcodea real sequence read deposited for this species

ITSOR235029.1 ↗387 bp

ACGT

ATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCTGAGGGCACGT …

Aegopodium podagraria isolate L6 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2rbcL4rbcLaITS3ITS1ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Aegopodium podagraria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 540 360 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Aegopodium podagraria3.54 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome records22–442n range42median42mode63records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 4232×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · ipcn-api-dl +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.

CCDB · slov-fl — Váchová M. & Májovský J., 1978: [Report], pp. 381-382. - In: Löve Á. (ed.), IOPB Chromosome Number Reports LXI, Taxon 27 /4.

CCDB · slov-fl — Mičieta K., 1982: Zytotaxonomischer Beitrag zur Flora des Javorníky-Gebirges II. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 29: 55-61.

CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.

CCDB · ipcn-api-dl — Mikcieta, K. 1982. Zytotaxonomischer Beitrag zur Flora des Javornaiky-Gebirges II. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 29: 55–61.

CCDB · ipcn-api-dl — Kartashova, N. N., L. A. MALAKHOVA, Koslova & N. A. Dubrova. 1974. Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk. 47–53.

CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1987. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II. Zapov. Belorussii Issl. 11: 62–69.

CCDB · ipcn-api-dl — Druskovic, B. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 11–14.

CCDB · ipcn-api-dl — Vachova, M. & J. Majovsky. 1980. In Chromosome number reports LXIX. Taxon 29: 720–721.

CCDB · ipcn-api-dl — Javurkova, V. 1980. In Chromosome number reports LXIX. Taxon 29: 713–714.

CCDB · ipcn-api-dl — PEEV, D. 1977. In IOPB chromosome number reports LV. Taxon 26: 107–109.

CCDB · ipcn-api-dl — Vachova, M. & J. Majovsky. 1978. In IOPB chromosome number reports LXI. Taxon 27: 375–392.

CCDB · ipcn-api-dl — KARTASHOVA, N. N., L. A. MALAKHOVA & A. A. KOZLOVA. 1974. Study of the chromosomes of the representatives of the Ob region flora. I. Number of chromosomes of the Tomsk district. Naucn. Dokl. Vyss. Shkoly, Biol. Nauki 4: 114–119.

CCDB · book-ipcn67-71 — GADELLA, TH. W.J., E. KLIPHUIS, & K.U. KRAMER. 1970. Zytotaxonomische Untersuchungen an Blutenpflanzen aus dem Osten Osterreichs. Wiss. Arbeiten Burgenland 44: 187-195.

CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1967. Chromosome numbers of flowering plants in the Netherlands III. Proc. Roy. Neth. Acad. Sci. Ser. c. 70: 7-20.

CCDB · book-fedorov — P6lya 1949

CCDB · book-fedorov — Gadella, Kliphuis 1967

CCDB · CromoCat 2015 — Druskovic, B. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 11-14.

CCDB · CromoCat 2015 — Gadella, Th. W. J., Kliphuis, E. & Kramer, K. U. (1970). Zytotaxonomische untersuchungen an blutenpflanzen aus dem Osten Osterreichs. Wiss. Arbeiten Burgenland 44: 187-195.

CCDB · CromoCat 2015 — Javurková, V. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 713-714.

CCDB · CromoCat 2015 — Peev, D. & N. Andreev. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 534-535.

CCDB · CromoCat 2015 — Peev, D. (1977a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LV]. Taxon 26(1): 107.

CCDB · CromoCat 2015 — Váchová, M. & J. Májovský. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXI]. Taxon 27(4): 381-382.

CCDB · CromoCat 2015 — Váchová, M. & J. Májovský. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 720-721.

2n 4417×CCDB · slov-fl · CCDB · poland · CCDB · ipcn-api-dl +4

CCDB · slov-fl — Váchová M. & Májovský J., 1980: [Report], pp. 720-721. - In: Löve Á. (ed.), Chromosome number reports LXIX, Taxon 29 /5-6.

CCDB · slov-fl — Váchová M. & Májovský J., 1978: [Report], pp. 381-382. - In: Löve Á. (ed.), IOPB Chromosome Number Reports LXI, Taxon 27 /4.

CCDB · poland — Skali?ska M., Ma?ecka J., Izmai?ow R. et al. 1974. Further studies in chromosome numbers of Polish Angiosperms. Tenth contribution. Acta Biol. Cracov. Ser. Bot. 17, 133-163.

CCDB · ipcn-api-dl — Laane, M. M. & T. Lie. 1985. Fremstilling av kromosompreparater med enkle metoder. Blyttia 1985: 7–15.

CCDB · ipcn-api-dl — Skalinska, M. 1974. Further studies in chromosome numbers of Polish angiosperms. X. Acta Biol. Cracov., Ser. Bot. 17: 133–164.

CCDB · book-fedorov — Melderis 1930

CCDB · book-fedorov — Tischler 1934, 1937

CCDB · book-fedorov — Rohweder

CCDB · book-fedorov — HAkansson 1953

CCDB · book-fedorov — LOve A., Love D. 1956b

CCDB · book-fedorov — Sorsa V. 1962.

CCDB · book-fedorov — RopAIOH 1967o

CCDB · book-atlas-flowering-plants — Hikansson 1953

CCDB · Cave1956 — Love & Love b

CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid

CCDB · CromoCat 2015 — Laane, M. M. & Lie, T. (1985). Fremstilling av kromosompreparater med enkle metoder. Blyttia 1985: 7-15.

CCDB · CromoCat 2015 — Skalinska, M. (1974). Further studies in chromosome numbers of Polish angiosperms. X. Acta Biol. Cracov., Ser. Bot. 17: 133–164.

2n 2213×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +3

CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.

CCDB · slov-fl — Hindáková M. & Schwarzová T., 1977: [Report], pp. 262. - In: Löve Á. (ed.), IOPB Chromosome number reports LVI, Taxon 26 /2-3.

CCDB · ipcn-api-dl — PEEV, D. & N. ANDREEV. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.

CCDB · ipcn-api-dl — HINDAKOVA, M. 1974. In Index to chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.

CCDB · ipcn-api-dl — HINDAKOVA, M. & J. Majovsky. 1977. In IOPB chromosome number reports LVI. Taxon 26: 257–274.

CCDB · ipcn-api-dl — Probatova. 2006. Chromosome numbers of plants of the Primorsky Territory, the Amur River basin and Magadan region. Bot. Žhurn. (Moscow & Leningrad) 91(3): 491–509.

CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.

CCDB · book-fedorov — Malheiros-Garde, Garde 1950; 1951

CCDB · book-fedorov — Garde, MalheirosGarde 1954

CCDB · book-atlas-flowering-plants — Garde & G. 1951

CCDB · CromoCat 2015 — Hindáková, M. & Schwarzová, T. (1977). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVI]. Taxon 26(2/3): 262.

CCDB · CromoCat 2015 — Peev, D. & N. Andreev. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 534-535.

CCDB · CromoCat 2015 — Probatova Probatova (2006). Further chromosome studies on vascular plant species from Sakhalin, Moneron and Kurile Islands. Biodivers. Biogeogr. Kuril Islands Sakhalin 2: 93–110

2n 381×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Stepanov, N. V. & E. N. Muratova. (1995). Chromosome numbers of some taxa of higher plants of Krasnoyarsk territory. Bot. Žurn. 80(6): 114-116.

2n 391×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Stepanov, N. V. & E. N. Muratova. (1995). Chromosome numbers of some taxa of higher plants of Krasnoyarsk territory. Bot. Žurn. 80(6): 114-116.

n 112×CCDB · iber-fl · CCDB · CromoCat 2015

CCDB · iber-fl — Contribuiao para o estudo cariolgico da familia Umbelliferae. II Malheiros-Gard, N. & A. Gard.Gent. Ibr.3: 23-35(1951).

CCDB · CromoCat 2015 — Malheiros, N. & Gardé, A. (1951a). Contribuiçao para o estudo cariológico da familia Umbelliferae. II. Genét. Ibér. 3: 23-35.

n 212×CCDB · ipcn-api-dl · CCDB · CromoCat 2015

CCDB · ipcn-api-dl — Wetschnig, W. & G. H. Leute. 1991. Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457–481.

CCDB · CromoCat 2015 — Wetschnig, W. & G. H. Leute. (1991). Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457-481.

n 222×CCDB · ipcn-api-dl · CCDB · CromoCat 2015

CCDB · ipcn-api-dl — Rostovtseva, T. S. 1976. Chromosome numbers of some species of the family Apiaceae in South Siberia. Bot. Žhurn. (Moscow & Leningrad) 61(1): 93–99.

CCDB · CromoCat 2015 — Rostovtseva, T. S. (1976). Chromosome numbers of some species from the family Apiaceae in South Siberia. Bot. Žurn. 61: 93-99.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.954 ↗

07Deep time~5.76 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin5.76 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type616 099 records

Wild obs. + sensor592 569

Museum / vouchered20 177

Cultivated / captive183

Other3 170

Origin

Native1 730

Introduced11 162

Range

Area of Occupancy AOO656 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 154 634≤1 km 131 447≤10 km 177 302>10 km 3 464

466 847 georeferenced · 125 722 without coordinates

Open the mapobservation + sensor592 569

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 901≤1 km 4 084≤10 km 10 767>10 km 700

16 452 georeferenced · 3 725 without coordinates

Open the institutions mapphysical evidence20 177

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy2% within 1 km

≤100 m 1≤10 km 38>10 km 15

54 georeferenced · 129 without coordinates

Open the mapnot free-living183

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions126 of 222 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	12 877
BFLlocation not on record	722
Helsinki, FI	474
BIO-UNIPIlocation not on record	338
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record	321
Moscow State Universitylocation not on record	298
Salzburg, AT	279
LDlocation not on record	261
Görlitz, DE	211
Olocation not on record	188
Turku, FI	177
Kuopio, FI	158
Karlsruhe, DE	158
MeiseBGlocation not on record	157
Uppsala, SE	142
Uniwersytet Warszawskilocation not on record	138
TROMlocation not on record	128
Oulu, FI	125
Trondheim, NO	123
Adam Mickiewicz University in Poznańlocation not on record	104
Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record	100
KMNlocation not on record	99
Oskarshamn, SE	93
SLU Artdatabankenlocation not on record	76
Bergen, NO	63
Tartu, EE	57
Jyväskylä, FI	50
Chongqing Museumlocation not on record	48
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	47
Provincia di Livornolocation not on record	47
Philadelphia, US	44
TUR-Alocation not on record	39
Berlin, DE	36
Tallinn, EE	36
Uniwersytet Śląski w Katowicachlocation not on record	36
Québec, CA	33
BRNUlocation not on record	32
Uniwersytet Opolskilocation not on record	31
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	28
Allentown, US	26
South Kensington, GB	24
GZUlocation not on record	24
Mlocation not on record	19
Université Lavallocation not on record	19
Acadia Universitylocation not on record	18
Garðabær, IS	18
Madison, US	17
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	17
Tula State Universitylocation not on record	16
Bern, CH	16
Burlington, US	15
Ann Arbor, US	15
Natural History Museum Rotterdamlocation not on record	15
Bronx, US	15
Frankfurt am Main	15
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	14
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	14
Montréal, CA	13
Saint John, CA	12
Porvoo, FI	12
Wlocation not on record	11
Institut und Museum fuer Geologie und Palaeontologielocation not on record	11
Porrentruy, CH	11
St. Paul, US	11
New Haven, US	10
DBF-NHMDlocation not on record	10
University of New Hampshirelocation not on record	10
Tilburg, NL	9
Otaru, JP	9
Palacký University in Olomouclocation not on record	9
CJBGlocation not on record	9
GJOlocation not on record	9
Bloomington, US	8
Zürich, CH	8
Christchurch, NZ	8
Dresden, DE	7
Fulda, DE	7
College Park, US	7
WTUlocation not on record	7
Philadelphia, US	7
Stockholm, SE	6
Denver, US	6
	6
The State Museum-Preserve "The Kulikovo pole"location not on record	6
inatura Erlebnis Naturschau GmbHlocation not on record	6
IDElocation not on record	5
BDBClocation not on record	5
Toronto, CA	5
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	5
Barcelona, ES	5
Zürich, CH	5
Frauenfeld, CH	5
PrivatHerblocation not on record	5
The Tula Region State Institution of Culture "Tula Museum Association"location not on record	5
Saint Louis, US	5
València, ES	4
Chapel Hill, US	4
Spearfish, US	4
Longwood Universitylocation not on record	4
Ivano-Frankove, UA	4
Rovaniemi, FI	4
Odawara, JP	4
SZUlocation not on record	4
Canberra, AU	4
University of Stellenboschlocation not on record	4
Millersville, US	4
Green Bay, US	3
Glarus, CH	3
Pullman, US	3
Mount Annan, AU	3
Corvallis, US	3
Durham, US	3
National Museum Waleslocation not on record	3
McWane Science Centerlocation not on record	3
San Jose State University, Museum of Birds and Mammalslocation not on record	3
Canadian Department of Agriculturelocation not on record	3
Portland, US	3
Universidade de Lisboa, Museu Bocagelocation not on record	3
BGBMlocation not on record	3
Morgantown, US	3
Forssa, FI	3
Salamanca, ES	3
BClocation not on record	3
Paris, FR	3
Plocation not on record	3
Edinburgh, GB	3
Xiamen, CN	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
Tromso University Museumlocation not on record	3
Chicago, US	3
Bando, JP	3
Naturalis Biodiversity Centerlocation not on record	3
Namur, BE	2
Hobart, AU	2
Philadelphia, US	2
Staten Island, US	2
Western Carolina Universitylocation not on record	2
DULlocation not on record	2
Kandalaksha State Nature Reservelocation not on record	2
Ypsilanti, US	2
Bourges, FR	2
Universidad de La Salle (La Salle)location not on record	2
LfUlocation not on record	2
Monastir, TN	2
Hamilton, US	2
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	2
Kyoto Universitylocation not on record	2
Adelaide, AU	2
Provo, US	2
Missoula, US	2
Dekalb, US	2
Museo Entomologico de Leonlocation not on record	2
Keene State Universitylocation not on record	2
Museum of the Rockieslocation not on record	2
Kew, GB	2
Sion, CH	2
Appalachian State Universitylocation not on record	2
BG-NMNHSlocation not on record	2
Davenport, US	2
IWEP FEB RASlocation not on record	2
München, DE	2
Finnish Museum of Natural Historylocation not on record	2
Umeå Universitylocation not on record	2
Sanda, JP	1
Minia, EG	1
H-Wolflocation not on record	1
Prioksko-Terrasnyi Biosphere Reservelocation not on record	1
Santa Barbara, US	1
Göteborg, SE	1
Catholic University of Pekinglocation not on record	1
STUlocation not on record	1
FLADlocation not on record	1
Urumqi, CN	1
Williamsburg, US	1
Urumqi, CN	1
Taipei, TW	1
Universidade Federal de Juiz de Foralocation not on record	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
Vancouver, CA	1
Portland, US	1
SNSNMClocation not on record	1
Madrid, ES	1
Riverside, US	1
Sapporo, JP	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Taipei, TW	1
Flagstaff, US	1
University of Guelph, OAC Herbariumlocation not on record	1
Victoria, CA	1
Museo Achille Folettolocation not on record	1
San Luis Obispo, US	1
Auckland, NZ	1
Clemson, US	1
Fukushima Universitylocation not on record	1
Anchorage, US	1
Wellington, NZ	1
Brussel, BE	1
BAYLUlocation not on record	1
Wuzhou, CN	1
Royal Botanic Garden Edinburghlocation not on record	1
Universite de Montreal, L'Herbier Marie-Victorinlocation not on record	1
Montréal, CA	1
Royal Botanical Gardenslocation not on record	1
Tsukuba, JP	1
Bangkok, TH	1
Antiguo Cuscatlán, SV	1
Jaén, ES	1
BSBIlocation not on record	1
Elikins, US	1
Boise, US	1
Whitehorse, CA	1
US	1
SWlocation not on record	1
Logan, US	1
Podgorica, ME	1
KR	1
NMBU:MINAlocation not on record	1
Kingston, US	1
Rotorua, NZ	1
ULBF-AGRlocation not on record	1
Johnson City, US	1
Boumlocation not on record	1

222 institutions · 19 229 of 20 177 vouchered records shown · 593 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA21 167 detections

Where the DNA of Aegopodium podagraria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21 167

Studies independent surveys3

Countries12

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 167 detections have coordinates

Open the map12 countries0

on road vergeRocher en bordure du fleuve a l'est de l"ile.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 4.50–17.4

Seasonal swing summer↔winter22.3 °C

Max temp (day)15.2 °C 5.70–21.2

Min temp (night)8.60 °C 3.20–13.2

Precipitation72.3 mm/mo 61.6–87.7

Air humidity63.7 % 59.6–67.5

Moisture balance19.0 mm/mo

Vapour deficit495 Pa 286–784

Wind speed3.50 m/s

Cloud cover48.5 % 38.1–59.7

CHELSA 1981–2010, ~9 km grid, at location & month of 19 532 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources15 archives

Size & morphology15

Life cycle & reproduction12

Diet & foraging2

Habitat & environment11

Physiology & chemistry9

Other traits1

Compound class profile5 classes

Documented compounds17 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

At a glance

When this lineage existed

Record type616 099 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions126 of 222 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type616 099 records