Aegomorphus modestus

(Blais, 1817) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Aegomorphus

At a glance

Occurrence records651

Data sources7

Biological traits0

DNA specimens12

eDNA detections11

Sources7 archives

Databases and archives Aegomorphus modestus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility651 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF651 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD12 specimens

01Narrative

Aegomorphus modestus is a species of beetle in the family Cerambycidae. It was described by Gyllenhal in 1817.Bezark, Larry G. A Photographic Catalog of the Cerambycidae of the World . Retrieved on 22 May 2012.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aegomorphus modestus has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

28Gmostly conserved

76Amostly conserved

79Tmostly conserved

97Cmostly conserved

172Tmostly conserved

178Tmostly conserved

181Amostly conserved

184Amostly conserved

214Gmostly conserved

217Tmostly conserved

223Tmostly conserved

262Amostly conserved

316Amostly conserved

322Cvariable

325Tmostly conserved

343Cmostly conserved

361Tmostly conserved

386Tmostly conserved

388Gmostly conserved

391Cmostly conserved

400Gmostly conserved

433Tmostly conserved

463Cmostly conserved

466Gvariable

478Gmostly conserved

500Cmostly conserved

553Gmostly conserved

562Tmostly conserved

565Tmostly conserved

634Cmostly conserved

640Tmostly conserved

AACTTTATATTTTCTATTCGGAGCTTGGGCCGGTATAGTAGGCACTTCTCTGAGAGTTCTAATTCGAACAGAATTAGGTAACCCTGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes9

BIN1

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthoderes laevicollissame family15.0%Casama vilissame order16.7%Microgoes oculatussame family16.9%Glaucotes yuccivorussame family17.6%Udranomia sallydaleyaesame order17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type651 records

Wild obs. + sensor620

Museum / vouchered31

Range

Area of Occupancy AOO2 024 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 318≤1 km 111≤10 km 21>10 km 83

533 georeferenced · 87 without coordinates

Open the mapobservation + sensor620

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Central Floridalocation not on record	13
Wuzhou, CN	4
Champaign, US	4
Saint John, CA	3
Montgomery, US	2
OSUClocation not on record	1

6 institutions · 27 of 31 vouchered records shown · 4 without an institution code

09Environmental DNA11 detections

Where the DNA of Aegomorphus modestus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 18.1–25.4

Seasonal swing summer↔winter22.5 °C

Max temp (day)25.9 °C 23.7–30.7

Min temp (night)18.0 °C 13.5–21.2

Precipitation92.8 mm/mo 75.5–121

Air humidity58.3 % 57.6–59.8

Moisture balance-47.2 mm/mo -69.8–17.5

Vapour deficit1,020 Pa 882–1,348

Wind speed2.70 m/s 2.20–3.90

Cloud cover39.8 % 30.0–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)