Aegires punctilucens

(d'Orbigny, 1837) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Aegiridae/Aegires

At a glance

Occurrence records622

Data sources7

Biological traits2

DNA specimens9

eDNA detections10

Sources7 archives

Databases and archives Aegires punctilucens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility412 records↗

OBISOcean Biodiversity Information System210 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS622 records

Environmental DNA2 datasets · 2 countries10 detections

DNA & barcodingBOLD9 specimens

01Narrative

Aegires punctilucens is a species of sea slug. It is a dorid nudibranch, a shell-less marine gastropod mollusc in the family Aegiridae.Gofas, S. (2015). Aegires punctilucens (d'Orbigny, 1837). In: MolluscaBase (2015). Accessed through: World Register of Marine Species on 2015-05-25

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aegires punctilucens has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

10Cmostly conserved

37Cmostly conserved

56Cmostly conserved

59Cmostly conserved

187Cmostly conserved

235Tvariable

238Amostly conserved

268Tmostly conserved

313Tmostly conserved

343Cmostly conserved

346Cmostly conserved

361Amostly conserved

581Tmostly conserved

628Tmostly conserved

TACTTTATACATTATCTTTGGTATATGGTGTGGGCTCCTCGGAACTGGGTTAAGTCTACTAATTCGTTTTGAGCTTGGAACGGCAGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.60%

Haplotypes4

BIN1

Most divergent pair2.0%

Europe

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type622 records

Wild obs. + sensor312

Museum / vouchered297

Other13

Range

Area of Occupancy AOO936 km²

Depth

0–200 m sunlit64

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 10.4 m · max 104 m · 64 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 266≤1 km 16≤10 km 1>10 km 4

287 georeferenced · 25 without coordinates

Open the mapobservation + sensor312

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 45≤1 km 36≤10 km 8>10 km 2

91 georeferenced · 206 without coordinates

Open the institutions mapphysical evidence297

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	29
Sydney, AU	16
DASSHlocation not on record	14
Gothenburg, SE	10
Bergen, NO	9
PNHSlocation not on record	7
CEFASlocation not on record	5
Paris, FR	4
Museums Victorialocation not on record	3
Museo Nacional de Ciencias Naturales (CSIC)location not on record	1
Citadel Hill, GB	1
University of Barcelona, Department of Evolutionary Biology, Ecology and Environmental Scienceslocation not on record	1
CASlocation not on record	1

13 institutions · 101 of 297 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Aegires punctilucens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys2

Countries2

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

On rockRed algaeOn kelpOn Kelp

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.50 °C 2.40–16.9

Seasonal swing summer↔winter13.2 °C

Max temp (day)7.70 °C 3.30–19.1

Min temp (night)3.80 °C 0.2–14.0

Precipitation213 mm/mo 73.0–283

Air humidity63.0 % 61.3–65.9

Moisture balance197 mm/mo

Vapour deficit357 Pa 250–741

Wind speed4.40 m/s

Cloud cover51.9 % 48.4–55.1

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)