Aeginopsis laurentii

Brandt, 1838 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Hydrozoa/Narcomedusae/Solmundaeginidae/Aeginopsis

At a glance

Occurrence records5 278

Data sources8

Biological traits4

DNA specimens23

eDNA detections558

Sources8 archives

Databases and archives Aeginopsis laurentii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 706 records↗

OBISOcean Biodiversity Information System2 572 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI558 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS5 278 records

Environmental DNA2 datasets · 2 countries558 detections

DNA & barcodingBOLD23 specimens

01Narrative

Aeginopsis is a genus of deep sea hydrozoan of the family Aeginidae. It is monotypic, with the single species Aeginopsis laurentii

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length2.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Other traits1

Vulnerability10

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aeginopsis laurentii has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes2

eDNA detections558

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P660 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.19%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 5 variable positions, in barcode order

193Gmostly conserved

262Amostly conserved

353Tmostly conserved

400Amostly conserved

547Gmostly conserved

TACATTATATTTAATATTTGCTTCATTTGCTGGTACAATCGGTACAAGTACTTCAATATTAATTAGAATAGATTTATCTAGCCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Solmundella bitentaculatasame family14.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type5 278 records

Wild obs. + sensor2 587

Museum / vouchered2 141

Other550

Range

Area of Occupancy AOO3 420 km²

Depth

0–200 m sunlit1 719

200–1000 m twilight375

1–4 km midnight189

>4 km abyssal10

median 74 m · max 10 000 m · 2 293 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 8≤1 km 6

14 georeferenced · 2 573 without coordinates

Open the mapobservation + sensor2 587

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤1 km 1≤10 km 8

9 georeferenced · 2 132 without coordinates

Open the institutions mapphysical evidence2 141

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ArcODlocation not on record	1 153
Washington, US	26
CASlocation not on record	10
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	4
Centre for Biodiversity Genomicslocation not on record	2
Maurice Lamontagne Institutelocation not on record	2
Copenhagen, DK	1
The Atlantic Reference Centre (ARC)location not on record	1
MZLUlocation not on record	1

9 institutions · 1 200 of 2 141 vouchered records shown · 82 without an institution code

09Environmental DNA558 detections

Where the DNA of Aeginopsis laurentii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found558

Studies independent surveys2

Countries2

Verifiable raw sequence linked539

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 558 detections have coordinates

Open the map2 countries0

Marine; pelagicOcean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.40 °C -11.8–11.4

Seasonal swing summer↔winter37.4 °C

Max temp (day)9.60 °C -9.50–15.5

Min temp (night)3.60 °C -14.3–8.80

Precipitation87.6 mm/mo 31.1–116

Air humidity63.5 % 60.2–73.5

Moisture balance30.6 mm/mo

Vapour deficit330 Pa 70.9–521

Wind speed4.20 m/s

Cloud cover51.0 % 43.3–61.0

CHELSA 1981–2010, ~9 km grid, at location & month of 554 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aeginopsis laurentii

At a glance

Sources8 archives

Size & morphology1

Habitat & environment2

Other traits1

At a glance

Record type5 278 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 278 records