Aegina citrea

Eschscholtz, 1829 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Hydrozoa/Narcomedusae/Aeginidae/Aegina

At a glance

Occurrence records2 249

Data sources8

Biological traits7

DNA specimens13

eDNA detections186

Sources8 archives

Databases and archives Aegina citrea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 119 records↗

OBISOcean Biodiversity Information System1 130 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI186 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS2 249 records

Environmental DNA8 datasets · 12 countries186 detections

DNA & barcodingBOLD13 specimens

Genome at a glanceNCBI≈769 Mbp

01Narrative

Aegina citrea is a species of deep sea hydrozoan of the family Aeginidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length5 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonepelagic

Other traits3

Depth max1 600 m

Depth min0 m

Vulnerability10

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aegina citrea has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes2

eDNA detections186

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

9Tmostly conserved

16Tmostly conserved

68Cmostly conserved

168Tmostly conserved

218Tmostly conserved

254Cmostly conserved

338Tmostly conserved

419Amostly conserved

524Avariable

565Tmostly conserved

CACTATATTTAATATTAGCAGCTTTTTCAGGAATGATAGGAACATCAATGTCAGTAATAATAAGATTCGAATTATCATCTCCAGGAACAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.49%

Haplotypes3

BIN1

Most divergent pair0.61%

Other

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceNCBI

The complete instruction manual Aegina citrea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈768 783 262 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aegina citrea0.77 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type2 249 records

Wild obs. + sensor1 672

Museum / vouchered564

Other13

Origin

Native1

Range

Area of Occupancy AOO2 012 km²

Depth

0–200 m sunlit683

200–1000 m twilight208

1–4 km midnight86

>4 km abyssal4

median 157.6 m · max 5 600 m · 981 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 166

167 georeferenced · 1 505 without coordinates

Open the mapobservation + sensor1 672

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 11≤1 km 53≤10 km 8>10 km 1

73 georeferenced · 491 without coordinates

Open the institutions mapphysical evidence564

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	39
Washington, US	29
	22
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	7
Santa Barbara Museum of Natural Historylocation not on record	5
AADClocation not on record	5
Brussels, BE	5
CASlocation not on record	4
RBINS-Scientific Heritagelocation not on record	4
Paris, FR	3
Sydney, AU	3
ArcODlocation not on record	2
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	2
Okinawa Institute for Science and Technologylocation not on record	2
New Haven, US	1
Tapachula, MX	1
Victoria, CA	1
Barcelona, ES	1
Hakai Institutelocation not on record	1
University of California San Diegolocation not on record	1
Edmonton, CA	1
Texas Cooperative Wildlife Collectionlocation not on record	1

22 institutions · 140 of 564 vouchered records shown · 186 without an institution code

09Environmental DNA186 detections

Where the DNA of Aegina citrea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found186

Studies independent surveys8

Countries12

Verifiable raw sequence linked13

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 186 detections have coordinates

Open the map12 countries0

PlanktonicAtlantic OceanMexico, Gulf ofPacific Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature16.3 °C 0.556–31.1

Conductivity49,984 µS/cm 39,963–60,227

Salinity35.2 PSU 33.7–36.2

Dissolved oxygen6.55 mg/L 2.07–9.24

Turbidity0.389 NTU 0.062–10.4

Nitrate2.25 µmol/L 0.1–8.30

Depth59.4 m 0–5,346

PelagicCoastal water

117 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.7 °C 8.90–27.2

Seasonal swing summer↔winter6.60 °C

Max temp (day)19.8 °C 9.60–27.9

Min temp (night)17.9 °C 8.20–26.2

Precipitation94.5 mm/mo 51.3–161

Air humidity60.6 % 56.5–66.0

Vapour deficit864 Pa 420–1,344

Cloud cover30.0 % 18.5–56.9

CHELSA 1981–2010, ~9 km grid, at location & month of 174 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aegina citrea

At a glance

Sources8 archives

Size & morphology1

Habitat & environment3

Other traits3

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 249 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type2 249 records