Aegilia describens

Walker, 1857 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Euteliidae/Aegilia

At a glance

Occurrence records27

Data sources7

Biological traits0

DNA specimens9

eDNA detections4

Sources7 archives

Databases and archives Aegilia describens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility27 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF27 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD9 specimens

01Narrative

Aegilia describens is a moth of the family Noctuidae first described by Francis Walker in 1858. It is found in Oriental tropics of India, Sri Lanka, to New Guinea, the Bismarck Islands and Queensland, also on Christmas Islands in the Indian Ocean. The caterpillar has a medium grass-green body with a distinct, 'pulsating' dark greenish dorsal line. A brownish, faint, lateral line extending to the dorsolateral area. Spiracles are orange divided by black. Pupation occurs in soil within a silk cocoon. Host plant includes Mesua ferrea.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aegilia describens has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes2

eDNA detections4

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

1Cvariable

16Cvariable

50Cvariable

73Avariable

97Tvariable

142Tvariable

202Cvariable

205Avariable

229Gvariable

238Cvariable

271Tvariable

274Cvariable

283Tvariable

367Tvariable

376Cvariable

400Tvariable

412Avariable

499Cvariable

500Cvariable

517Cvariable

562Tvariable

604Tvariable

616Tvariable

CACATTATATTTTATCTTTGGAATTTGAGCAGGAATAGTAGGAACTTCACTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes3

BINs2

Most divergent pair3.5%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aegilia sundascribenssame genus3.4%Aegilia indescribenssame genus4.8%Calophasidia canasame order6.5%Schinia hulstiasame order7.3%Schinia tobiasame order7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type27 records

Wild obs. + sensor13

Museum / vouchered14

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy15% within 1 km

≤100 m 1≤1 km 1≤10 km 7>10 km 4

13 georeferenced

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	5
Loyola College, Entomology Research Institutelocation not on record	1

2 institutions · 6 of 14 vouchered records shown · 6 without an institution code

09Environmental DNA4 detections

Where the DNA of Aegilia describens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 21.1–21.1

Seasonal swing summer↔winter4.40 °C

Max temp (day)26.1 °C

Min temp (night)15.2 °C 15.3–15.2

Precipitation99.9 mm/mo

Air humidity58.5 %

Moisture balance-46.2 mm/mo

Vapour deficit1,035 Pa

Wind speed1.30 m/s

Cloud cover13.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)