Aedia sericea

Butler, 1882 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Aedia

At a glance

Occurrence records21

Data sources4

Biological traits0

DNA specimens5

eDNA detections3

Sources4 archives

Databases and archives Aedia sericea's data was compiled from.

GBIFGlobal Biodiversity Information Facility21 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF21 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD5 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedia sericea has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P164 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.61%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

26Tmostly conserved

158Amostly conserved

TTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGTGCCCCAGATATAGCTTTCCCCCGAATAAATAACA …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type21 records

Wild obs. + sensor1

Museum / vouchered20

Origin

Native9

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SUVlocation not on record	9
Australian National Insect Collectionlocation not on record	3
Mangilao, GU	3
Essig Museum of Entomologylocation not on record	2
Museums Victorialocation not on record	1
Cornell University Insect Collectionlocation not on record	1

6 institutions · 19 of 20 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Aedia sericea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 21.1–25.2

Seasonal swing summer↔winter8.10 °C

Max temp (day)24.9 °C 23.6–28.1

Min temp (night)19.0 °C 18.6–22.1

Precipitation74.9 mm/mo 36.3–237

Air humidity63.1 % 60.8–64.1

Moisture balance-27.4 mm/mo -91.9–92.0

Vapour deficit980 Pa 973–1,149

Wind speed2.20 m/s 2.10–2.80

Cloud cover32.0 % 25.3–49.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)