Aedia funesta

Esper · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Aedia

At a glance

Occurrence records5 531

Data sources7

Biological traits0

DNA specimens20

eDNA detections21

Sources7 archives

Databases and archives Aedia funesta's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 531 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 531 records

Environmental DNA1 datasets · 8 countries21 detections

DNA & barcodingBOLD20 specimens

01Narrative

Aedia funesta or the druid is a moth of the family Erebidae. It is found in Central Europe, Southern Europe, Anatolia and Iran. There are two generations per year. Adults are on wing from April to June and from August to October. The larvae feed on Calystegia sepium and Convolvulus arvensis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedia funesta has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections21

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

34Gmostly conserved

287Tmostly conserved

304Cmostly conserved

352Amostly conserved

484Tmostly conserved

517Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGGATAATTGGTACCTCACTTAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes4

BIN1

Most divergent pair1.5%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pseudaclytia opponenssame order8.2%Idalima leonorasame family8.2%Schinia crotchiisame family8.5%Schinia ferrisisame family8.5%Schinia hulstiasame family8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 531 records

Wild obs. + sensor4 563

Museum / vouchered703

Other265

Origin

Native803

Range

Area of Occupancy AOO6 552 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1 419≤1 km 433≤10 km 1 797>10 km 46

3 695 georeferenced · 868 without coordinates

Open the mapobservation + sensor4 563

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 60≤1 km 140≤10 km 409>10 km 32

641 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence703

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	101
DanishLepidopterologicalSocietylocation not on record	82
Geneva, CH	61
SFRAlocation not on record	37
Bern, CH	24
Zürich, CH	22
Sion, CH	21
Musee d'Histoire Naturallelocation not on record	17
Tartu, EE	16
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	15
Archäologie und Museum Baselland - Museum.BLlocation not on record	14
Adam Mickiewicz University in Poznańlocation not on record	11
Paro, BT	10
Naturmuseum St. Gallenlocation not on record	9
Muzeum Górnośląskie w Bytomiulocation not on record	7
Philadelphia, US	7
Natural History Museum Rotterdamlocation not on record	6
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	6
Uniwersytet Łódzkilocation not on record	5
ZSMlocation not on record	4
Salzburg, AT	3
Glarus, CH	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
МПХУlocation not on record	2
Universität Zürich, Naturhistorisches Museumlocation not on record	2
ЗММУlocation not on record	2
Tallinn, EE	2
John May Museum of Natural Historylocation not on record	1

28 institutions · 491 of 703 vouchered records shown · 212 without an institution code

09Environmental DNA21 detections

Where the DNA of Aedia funesta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map8 countries0

Private gardenprivate garden

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 2.90–20.5

Seasonal swing summer↔winter20.9 °C

Max temp (day)22.2 °C 7.00–24.2

Min temp (night)13.1 °C -1.90–15.3

Precipitation77.7 mm/mo 45.7–131

Air humidity58.2 % 55.8–62.3

Moisture balance-45.5 mm/mo -82.3–62.3

Vapour deficit871 Pa 315–1,005

Wind speed3.00 m/s 2.20–4.20

Cloud cover38.6 % 33.7–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedia funesta

At a glance

Sources7 archives

At a glance

Record type5 531 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 531 records