Aechmea bromeliifolia

(Rudge) Baker ex Benth. & Hook.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Aechmea

At a glance

Occurrence records516

Data sources10

Biological traits15

DNA specimens9

eDNA detections9

Sources10 archives

Databases and archives Aechmea bromeliifolia's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility516 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF516 records

Environmental DNA1 datasets · 0 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 50

01Narrative

Aechmea bromeliifolia is a bromeliad native to southern Mexico, Central America, Trinidad, and South America as far south as northern Argentina.Kew World Checklist of Selected Plant FamiliesVersieux, L.M. & Wendt, T. (2006). Checklist of Bromeliaceae of Minas Gerais, Brazil, with notes on taxonomy and endemism. Selbyana 27: 107-146.Sant'Ana Melhem, T., das Graças Lapa Wanderley, M., Ehlin Martins, S., Jung-Mendaçolli, S.L., Shepherd, G.J. & Kirizawa, M. (eds.) (2007). Flora Fanerogâmica do Estado de São Paulo 5: 1-476. Instituto de Botânica, São Paulo.Nelson Sutherland, C.H. (2008). Catálogo de las plantes vasculares de Honduras. Espermatofitas: 1-1576. SERNA/Guaymuras, Tegucigalpa, Honduras.Hokche, O., Berry, P.E. & Huber, O. (eds.) (2008). Nuevo Catálogo de la Flora Vascular de Venezuela: 1-859. Fundación Instituto Botánico de Venezuela.Martinelli, G., Magalhães Vieira, C., Gonzalez, M., Leitman, P., Piratininga, A. Ferreira da Costa, A. & Campostrini Forzza, R. (2008). Bromeliaceae da Mata Atlântica Brasileira: lista de espécies, distribuição e conservação. Rodriguésia; Revista do Instituto de Biologia Vegetal, Jardim Botânico e Estaçao Biologica do Itatiaya 59: 209-258.Versieux, L.M., Wendt, T., Batista Louzada, R. & das Graças Lapa Wanderley, M. (2008 publ. 2009). Bromeliaceae da Cadeia do Espinhaço. Megadiversidade 4: 98-110.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass2.5 mg

Life cycle & reproduction3

Life formepiphyte or lithophyte

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 600 m

Elevation min0 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTCampo Rupestre, Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta de Terra Firme, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial)

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayCAM

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aechmea bromeliifolia has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes2

GenBank sequences10

eDNA detections9

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLJN202118.1 ↗632 bp

ACGT

TACAAATTGACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCG …

Aechmea bromeliifolia ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK8★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Aechmea bromeliifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 50 n = 25

Ploidydiploid inferred

Chromosome records50–502n range50median50mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 502×CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Gitaí, J. 2005. Chromosomal features and evolution of Bromeliaceae. Pl. Syst. Evol. 253: 65–80.

CCDB · book-atlas-flowering-plants — Lindschau 1933

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type516 records

Wild obs. + sensor459

Museum / vouchered51

Cultivated / captive1

Other5

Origin

Native15

Range

Area of Occupancy AOO1 392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 169≤1 km 67≤10 km 39>10 km 25

300 georeferenced · 159 without coordinates

Open the mapobservation + sensor459

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence51

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CEPLAClocation not on record	9
St. Augustine, TT	8
UFPElocation not on record	5
UNESP-FCAlocation not on record	4
Mexico City, MX	2
Altos de Pipe, VE	2
Kew, GB	2
Austin, US	2
Durango, MX	2
Mérida, MX	2
Universidade de São Paulolocation not on record	2
Miami, US	2
INMAlocation not on record	1
Bronx, US	1
Buenos Aires, AR	1
Madison, US	1
Göteborg, SE	1
UNESP-RClocation not on record	1
UFMGlocation not on record	1
Brasília, BR	1

20 institutions · 50 of 51 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA9 detections

Where the DNA of Aechmea bromeliifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)