Aechmea blanchetiana

(Baker) L.B.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Aechmea

At a glance

Occurrence records306

Data sources8

Biological traits10

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Aechmea blanchetiana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility306 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF306 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Aechmea blanchetiana is a bromeliad typical of Atlantic Coast restingas vegetation which is an ecosystem of Atlantic Forest biome of eastern Brazil. This plant grows from the State of Bahia south to Espírito Santo.Kew World Checklist of Selected Plant FamiliesMartinelli, G., Magalhães Vieira, C., Gonzalez, M., Leitman, P., Piratininga, A. Ferreira da Costa, A. & Campostrini Forzza, R. (2008). Bromeliaceae da Mata Atlântica Brasileira: lista de espécies, distribuição e conservação. Rodriguésia; Revista do Instituto de Biologia Vegetal, Jardim Botânico e Estaçao Biologica do Itatiaya 59: 209-258. It is often grown elsewhere as an ornamental plant. The orange form of Aechmea blanchetiana Aechmea blanchetiana growing in Naples, Florida

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formepiphyte

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTRestinga

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aechmea blanchetiana has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKMT026340.1 ↗782 bpBrazil

ACGT

ATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCAATGCCGGATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCCACG …

Aechmea blanchetiana isolate BE393 maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2

plant barcode

08Occurrence & distribution

Record type306 records

Wild obs. + sensor84

Museum / vouchered222

Origin

Native79

Range

Area of Occupancy AOO632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 40≤1 km 20≤10 km 4>10 km 6

70 georeferenced · 14 without coordinates

Open the mapobservation + sensor84

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤1 km 3≤10 km 3>10 km 2

8 georeferenced · 214 without coordinates

Open the institutions mapphysical evidence222

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Salvador, BR	42
UFESlocation not on record	25
Bronx, US	22
UFBAlocation not on record	21
Federal University of Espírito Santolocation not on record	16
Universidade Federal do Espírito Santolocation not on record	16
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	9
JBRJlocation not on record	7
San Jose State University, Museum of Birds and Mammalslocation not on record	6
CEPLAClocation not on record	6
Université de Bordeauxlocation not on record	4
INMAlocation not on record	4
Laboratorio de Ictiologialocation not on record	4
Denver, US	4
Kew, GB	4
Cruz das Almas, BR	3
UFPElocation not on record	3
University of Stellenboschlocation not on record	3
South Kensington, GB	3
Universidade Federal do Vale do São Franciscolocation not on record	2
Santa Teresa, BR	2
Feira de Santana, BR	2
Paris, FR	2
UESBlocation not on record	2
HUENFlocation not on record	1
Chicago, US	1
Universidade Federal do Ceara, Departamento de Biologialocation not on record	1
Brasília, BR	1
UFRRJlocation not on record	1
Departamento de Sistematica e Ecologialocation not on record	1
Cenargenlocation not on record	1
URCAlocation not on record	1
Chaguaramas, TT	1

33 institutions · 221 of 222 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Aechmea blanchetiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)